Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27945
Trapped Gene
Lmbrd2 (ENSMUSG00000039704)
Vector Insertion
Chr 15: 9116458 - 9124430
Public Clones not available
Private Clones OST43496 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000395218 (Chr15:9116352..9116457 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATTCCACTCGGAACAGAA Chr15:9116384..9116403 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000395218 (Chr15:9116352..9116457 +)
Downstram Exon
ENSMUSE00000386690 (Chr15:9124431..9124557 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATTCCACTCGGAACAGAA Chr15:9116384..9116403 60.05 50 AGCCCTGGTGTATTTGGATG Chr15:9124453..9124472 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000440374 Chr15:9070377..9070496 TTCTGAGTCCCTTCCAGACG Chr15:9070457..9070476 60.38 55
upstream ENSMUSE00000410796 Chr15:9078732..9078961 CATGAGTCAGTTTGGCTGGA Chr15:9078750..9078769 59.83 50
upstream ENSMUSE00000370306 Chr15:9079211..9079308 CAGCCCTCCTGAAAATACCA Chr15:9079249..9079268 60.07 50
upstream ENSMUSE00000270229 Chr15:9081240..9081335 ATGTTTCAAGCCGTGGAGTT Chr15:9081249..9081268 59.6 45
upstream ENSMUSE00000270223 Chr15:9085962..9086129 ATCACCGGCAAGATCAAAAC Chr15:9086011..9086030 59.94 45
upstream ENSMUSE00000270169 Chr15:9086969..9087179 CCTCGGTCATACTGGAATGG Chr15:9087060..9087079 60.33 55
upstream ENSMUSE00000270162 Chr15:9095544..9095618 ACAACCACCCACTGAGGAAG Chr15:9095575..9095594 60 55
upstream ENSMUSE00000270154 Chr15:9100853..9100966 CGAAAAGCGCAATACCTACC Chr15:9100912..9100931 59.74 50
upstream ENSMUSE00000270149 Chr15:9101813..9101996 TCAAGTGCAATGGCAGATTC Chr15:9101845..9101864 59.81 45
upstream ENSMUSE00000650212 Chr15:9104880..9105061 GGTACTGGGAATGCCTTTTG Chr15:9104883..9104902 59.43 50
upstream ENSMUSE00000270201 Chr15:9105542..9105675 CAGGATCCGCGTGTTTAACT Chr15:9105598..9105617 60.13 50
upstream ENSMUSE00000505076 Chr15:9107408..9107513 GAATACCCAGCCAACTGCAT Chr15:9107486..9107505 59.96 50
upstream ENSMUSE00000270190 Chr15:9108018..9108115 TCTCTGCATCGCTACGTATTTT Chr15:9108092..9108113 59.06 40.91
upstream ENSMUSE00000270142 Chr15:9112241..9112344 ACCCGTTGTTTGAATCTGCT Chr15:9112248..9112267 59.6 45
upstream ENSMUSE00000270138 Chr15:9113666..9113712 GCAAAGACAAGAGGAAGGTGA Chr15:9113679..9113699 59.46 47.62
upstream ENSMUSE00000395218 Chr15:9116352..9116457 GGATTCCACTCGGAACAGAA Chr15:9116384..9116403 60.05 50

*** Putative Vector Insertion (Chr 15: 9116458 - 9124430) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000386690 Chr15:9124431..9124557 AGCCCTGGTGTATTTGGATG Chr15:9124453..9124472 59.81 50
downstream ENSMUSE00000563716 Chr15:9126412..9128074 GAGAAACTGCCCTGGACAAG Chr15:9127889..9127908 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAAAGAGGCCAAGGAGAC Chr15:9116489..9116509 59.82 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAAAGAGGCCAAGGAGAC Chr15:9116489..9116509 59.82 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039704