Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2797
Trapped Gene
Hexa (ENSMUSG00000025232)
Vector Insertion
Chr 9: 59387784 - 59401939
Public Clones AH0307 (sanger) AF0619 (sanger) M076C03 (ggtc) M076D06 (ggtc) M076C07 (ggtc)
M077E01 (ggtc) M076C02 (ggtc) M076E04 (ggtc) M076A04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000232908 (Chr9:59387504..59387783 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGCTACCGTAACCTGCTC Chr9:59387727..59387746 59.9 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000232908 (Chr9:59387504..59387783 +)
Downstram Exon
ENSMUSE00000232890 (Chr9:59401940..59402032 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGCTACCGTAACCTGCTC Chr9:59387727..59387746 59.9 60 CCCCAACGTTTGCTGTTTAT Chr9:59401962..59401981 59.86 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000232908 Chr9:59387504..59387783 GACGCTACCGTAACCTGCTC Chr9:59387727..59387746 59.9 60

*** Putative Vector Insertion (Chr 9: 59387784 - 59401939) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000232890 Chr9:59401940..59402032 CCCCAACGTTTGCTGTTTAT Chr9:59401962..59401981 59.86 45
downstream ENSMUSE00000232873 Chr9:59403146..59403211 GAGGCGAGTAAACACTGGTCA Chr9:59403187..59403207 60.31 52.38
downstream ENSMUSE00000232856 Chr9:59404679..59404725 CCCTCAGCTGATTTCCAAAC Chr9:59404724..59404743 59.67 50
downstream ENSMUSE00000232837 Chr9:59405095..59405205 GGCGAGATGTATCCAGCAGT Chr9:59405173..59405192 60.25 55
downstream ENSMUSE00000149101 Chr9:59405841..59405942 GAAGGAAGAGTCGTCCACCA Chr9:59405906..59405925 60.24 55
downstream ENSMUSE00000149110 Chr9:59407131..59407263 AAAGTGTGGCCAGGAGTGTC Chr9:59407252..59407271 60.16 55
downstream ENSMUSE00000149100 Chr9:59408704..59408884 AAAGTCCGGGAAGACTGAGC Chr9:59408846..59408865 60.77 55
downstream ENSMUSE00000149106 Chr9:59409750..59409833 No primer for this exon
downstream ENSMUSE00000149107 Chr9:59410103..59410175 TCAGAGACGATGTCCAGCAG Chr9:59410126..59410145 60.14 55
downstream ENSMUSE00000149104 Chr9:59410674..59410857 GTTCAGGTACCAGGGAGCAG Chr9:59410799..59410818 59.72 60
downstream ENSMUSE00000149111 Chr9:59411031..59411121 CTCCAATGACCAGAGCCTTC Chr9:59411066..59411085 59.8 55
downstream ENSMUSE00000149105 Chr9:59411690..59411794 ACAACGGAAATGCGACAAAC Chr9:59411786..59411805 60.93 45
downstream ENSMUSE00000232641 Chr9:59412628..59412914 TCAAAGGACAGCAACCTCCT Chr9:59412734..59412753 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTTTGAGTGTTGGAGCTG Chr9:59387770..59387790 60.82 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAGTCACTGCCCGGTTCT Chr9:59396785..59396805 62.65 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025232