Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27978
Trapped Gene
Mthfd1l (ENSMUSG00000040675)
Vector Insertion
Chr 10: 6258308 - 6262664
Public Clones not available
Private Clones OST43063 (lexicon) OST36731 (lexicon)
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000441341 (Chr10:6262665..6262804 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACGTTGTCGTGCTGGTAG Chr10:6262706..6262725 60.36 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000441341 (Chr10:6262665..6262804 -)
Downstram Exon
ENSMUSE00000441327 (Chr10:6258266..6258307 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACGTTGTCGTGCTGGTAG Chr10:6262706..6262725 60.36 55 GAGAGGAACCCCAGCAGTTA Chr10:6258265..6258284 59.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000326438 Chr10:6373063..6373397 No primer for this exon
upstream ENSMUSE00000666815 Chr10:6373063..6373428 No primer for this exon
upstream ENSMUSE00000708310 Chr10:6373063..6373423 No primer for this exon
upstream ENSMUSE00000710810 Chr10:6373063..6373410 No primer for this exon
upstream ENSMUSE00000326431 Chr10:6367823..6367907 TCCAAGGAAGTGCTGAGCTT Chr10:6367872..6367891 60.13 50
upstream ENSMUSE00000326423 Chr10:6366275..6366325 CCGGTGATGACAATTTGATG Chr10:6366305..6366324 59.77 45
upstream ENSMUSE00000326415 Chr10:6366137..6366190 GCTGGTCTGGACATCACTCA Chr10:6366171..6366190 59.83 55
upstream ENSMUSE00000326406 Chr10:6362333..6362457 ATGAAGACCCCAGAGTGCAT Chr10:6362413..6362432 59.53 50
upstream ENSMUSE00000326402 Chr10:6360875..6360975 TCAATCTGGGGAAGCTCGTA Chr10:6360945..6360964 60.73 50
upstream ENSMUSE00000326395 Chr10:6356544..6356680 No primer for this exon
upstream ENSMUSE00000441421 Chr10:6338688..6338799 CCATCAGGAACCACCATTCT Chr10:6338714..6338733 59.78 50
upstream ENSMUSE00000441414 Chr10:6330936..6331027 GAGAGCGTGAGTCTCCTTGC Chr10:6330955..6330974 60.29 60
upstream ENSMUSE00000441408 Chr10:6329720..6329817 CAGAGAGCAGCAACATCGAA Chr10:6329769..6329788 60.29 50
upstream ENSMUSE00000441403 Chr10:6327942..6328115 AAGTCCAATTGTCCCTGCTG Chr10:6327989..6328008 60.11 50
upstream ENSMUSE00000441397 Chr10:6318010..6318146 GGACCCACTTTTGGAGTGAA Chr10:6318012..6318031 59.94 50
upstream ENSMUSE00000441389 Chr10:6315805..6315851 CTGCAGGAGGTGGATATGCT Chr10:6315826..6315845 60.24 55
upstream ENSMUSE00000441383 Chr10:6314202..6314309 AGCCATCGACACGAGAATTT Chr10:6314228..6314247 59.7 45
upstream ENSMUSE00000441377 Chr10:6313178..6313252 No primer for this exon
upstream ENSMUSE00000441374 Chr10:6311223..6311325 ACTGACCGAGGAGGAAGTGA Chr10:6311274..6311293 59.83 55
upstream ENSMUSE00000441370 Chr10:6304692..6304768 GACACGAACGACCGATTTCT Chr10:6304744..6304763 60.12 50
upstream ENSMUSE00000326344 Chr10:6298570..6298710 ACATGAAAGAGCGGCTAGGA Chr10:6298624..6298643 59.98 50
upstream ENSMUSE00000326333 Chr10:6298273..6298341 TTTGATGAAAGACGCCATCA Chr10:6298299..6298318 60.2 40
upstream ENSMUSE00000326288 Chr10:6289680..6289791 No primer for this exon
upstream ENSMUSE00000441341 Chr10:6262665..6262804 CAACGTTGTCGTGCTGGTAG Chr10:6262706..6262725 60.36 55

*** Putative Vector Insertion (Chr 10: 6258308 - 6262664) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000441327 Chr10:6258266..6258307 GAGAGGAACCCCAGCAGTTA Chr10:6258265..6258284 59.28 55
downstream ENSMUSE00000441325 Chr10:6257146..6257246 GCTGAGCGATCTGAATTTGC Chr10:6257164..6257183 61.03 50
downstream ENSMUSE00000441320 Chr10:6256368..6256545 TTTAGCGAGCTCACACACCA Chr10:6256478..6256497 60.6 50
downstream ENSMUSE00000441313 Chr10:6243198..6243305 CTCAATGTCCTTGGCTCCAT Chr10:6243221..6243240 60.07 50
downstream ENSMUSE00000441308 Chr10:6240012..6240164 CGTTCCCACCAAAGGATAAA Chr10:6239990..6240009 59.79 45
downstream ENSMUSE00000441470 Chr10:6198415..6198532 TGCTCCGTTTCTGTGTCAAG Chr10:6198440..6198459 60.03 50
downstream ENSMUSE00000705489 Chr10:6190438..6190891 AAACTCCAAAGACGGAAGCA Chr10:6190553..6190572 59.85 45
downstream ENSMUSE00000577400 Chr10:6190430..6190999 AACACCACTTGGCTGGAAAC Chr10:6190715..6190734 60.01 50
downstream ENSMUSE00000711680 Chr10:6179460..6180060 GTGCTTTTCGCTACGAGACC Chr10:6179874..6179893 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCTCTGAAGATGCATGGAG Chr10:6259674..6259695 60.11 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTCTGAAGATGCATGGAG Chr10:6259674..6259695 60.11 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040675