Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27987
Trapped Gene
Abcd3 (ENSMUSG00000028127)
Vector Insertion
Chr 3: 121494741 - 121495721
Public Clones IST12866A11 (tigm)
Private Clones OST42939 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176507 (Chr3:121495722..121495820 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAAGAGCGAGCTGTGGTG Chr3:121495791..121495810 60.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176507 (Chr3:121495722..121495820 -)
Downstram Exon
ENSMUSE00000176520 (Chr3:121494652..121494740 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAAGAGCGAGCTGTGGTG Chr3:121495791..121495810 60.73 55 CTCAATGAGCGTCCCATTCT Chr3:121494632..121494651 60.22 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000374652 Chr3:121517927..121518114 AGTACTTGACGGCACGGAAC Chr3:121518001..121518020 60.18 55
upstream ENSMUSE00000176535 Chr3:121499367..121499403 GTGGAAAACCGCCATTACAG Chr3:121499376..121499395 60.37 50
upstream ENSMUSE00000176507 Chr3:121495722..121495820 AGAAAGAGCGAGCTGTGGTG Chr3:121495791..121495810 60.73 55

*** Putative Vector Insertion (Chr 3: 121494741 - 121495721) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176520 Chr3:121494652..121494740 CTCAATGAGCGTCCCATTCT Chr3:121494632..121494651 60.22 50
downstream ENSMUSE00000176509 Chr3:121488920..121488989 GGCAGCGATGAAGTTGAATA Chr3:121488907..121488926 58.87 45
downstream ENSMUSE00000176531 Chr3:121487391..121487488 GGTACCGTGTGAGCCTGACT Chr3:121487388..121487407 60.18 60
downstream ENSMUSE00000176521 Chr3:121486929..121487052 TGTGTAAGCAGCTGGTCTGG Chr3:121486962..121486981 60.05 55
downstream ENSMUSE00000176529 Chr3:121484846..121484902 No primer for this exon
downstream ENSMUSE00000176514 Chr3:121482473..121482615 CCAATGGGTCTTCTGAGTCG Chr3:121482523..121482542 60.65 55
downstream ENSMUSE00000176516 Chr3:121479915..121479984 TCTCCCGTTTATTCCCATTG Chr3:121479925..121479944 59.76 45
downstream ENSMUSE00000176537 Chr3:121478720..121478789 No primer for this exon
downstream ENSMUSE00000176517 Chr3:121478535..121478632 TCCAGCAGCTCTGAGTGTGT Chr3:121478514..121478533 59.76 55
downstream ENSMUSE00000176512 Chr3:121478349..121478440 CGACCCAAAGCTTGAGACAT Chr3:121478366..121478385 60.26 50
downstream ENSMUSE00000176505 Chr3:121477060..121477151 No primer for this exon
downstream ENSMUSE00000176522 Chr3:121476907..121476979 GGACTAGCTTGTGCTCCTTCA Chr3:121476933..121476953 59.63 52.38
downstream ENSMUSE00000176523 Chr3:121475221..121475284 ATGTCACCATTTGGTGTTGC Chr3:121475224..121475243 59.27 45
downstream ENSMUSE00000176533 Chr3:121472433..121472510 TTGGACCACAAATCAGAACG Chr3:121472452..121472471 59.54 45
downstream ENSMUSE00000176511 Chr3:121472270..121472335 CCCTCCAAAAAGAGGCCATA Chr3:121472293..121472312 61.29 50
downstream ENSMUSE00000265720 Chr3:121472085..121472174 CTGGTCAGAGATCCCCCTCT Chr3:121472063..121472082 60.6 60
downstream ENSMUSE00000176515 Chr3:121471540..121471659 CCTCCGCTGAGTACATCCAT Chr3:121471537..121471556 60.1 55
downstream ENSMUSE00000176519 Chr3:121467919..121468023 TCATCCAAAATGGCAAACTG Chr3:121467955..121467974 59.52 40
downstream ENSMUSE00000176503 Chr3:121464333..121464389 AACGGTAAAGAGGGTGATGC Chr3:121464344..121464363 59.06 50
downstream ENSMUSE00000425857 Chr3:121461828..121463227 CCACTACCATGGGGCATAAG Chr3:121462679..121462698 60.21 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCATGTAATCGCCTTGCAG Chr3:121495656..121495677 60.11 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATTCATGCGTGACTGGGAAA Chr3:121495657..121495678 61.4 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr3:121495751..121495771 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGAAAGAGCGAGCTGTGGTG Chr3:121495789..121495809 60.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028127