Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27998
Trapped Gene
Rab39 (ENSMUSG00000055069)
Vector Insertion
Chr 9: 53494842 - 53513993
Public Clones CMHD-GT_243G11-3 (cmhd) IST12074C7 (tigm) IST12074C7 (tigm)
Private Clones OST42723 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000447063 (Chr9:53513994..53514337 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTCCGCCTTATTGTGATCG Chr9:53514178..53514197 60.47 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000447063 (Chr9:53513994..53514337 -)
Downstram Exon
ENSMUSE00000447052 (Chr9:53492215..53494841 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTCCGCCTTATTGTGATCG Chr9:53514178..53514197 60.47 50 TTTTCTGGGCTTGACTGCTT Chr9:53494408..53494427 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447063 Chr9:53513994..53514337 GTTCCGCCTTATTGTGATCG Chr9:53514178..53514197 60.47 50

*** Putative Vector Insertion (Chr 9: 53494842 - 53513993) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000447052 Chr9:53492215..53494841 TTTTCTGGGCTTGACTGCTT Chr9:53494408..53494427 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAGCGCTCGGTGCTCTAAT Chr9:53498938..53498958 59.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACAGGCTCTCGAAAGTGC Chr9:53507957..53507977 63.4 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCACAGATATGGGGCAGAGA Chr9:53508290..53508310 59.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCACAGATATGGGGCAGAGA Chr9:53508290..53508310 59.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055069