Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28005
Trapped Gene
Fbxw9 (ENSMUSG00000008167)
Vector Insertion
Chr 8: 87588396 - 87588479
Public Clones not available
Private Clones OST42551 (lexicon)
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000635499 (Chr8:87588283..87588395 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000635499 (Chr8:87588283..87588395 +)
Downstram Exon
ENSMUSE00000635498 (Chr8:87588480..87588571 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459676 Chr8:87584018..87584435 No primer for this exon
upstream ENSMUSE00000459659 Chr8:87585845..87585984 No primer for this exon
upstream ENSMUSE00000635500 Chr8:87586071..87586199 No primer for this exon
upstream ENSMUSE00000635499 Chr8:87588283..87588395 No primer for this exon

*** Putative Vector Insertion (Chr 8: 87588396 - 87588479) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635498 Chr8:87588480..87588571 No primer for this exon
downstream ENSMUSE00000606585 Chr8:87589720..87589868 No primer for this exon
downstream ENSMUSE00000606584 Chr8:87589955..87590068 No primer for this exon
downstream ENSMUSE00000606583 Chr8:87590172..87590261 No primer for this exon
downstream ENSMUSE00000606582 Chr8:87590344..87590409 No primer for this exon
downstream ENSMUSE00000211896 Chr8:87590489..87591017 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr8:87588446..87588466 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCAGCAGTTTGGAGAGAT Chr8:87588374..87588394 61.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008167