Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28044
Trapped Gene
AA536717 (ENSMUSG00000039599)
Vector Insertion
Chr 14: 21170533 - 21170639
Public Clones not available
Private Clones OST41557 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000564512 (Chr14:21170534..21170638 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCACGCTCTTAACCACCA Chr14:21170547..21170566 60.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000564512 (Chr14:21170534..21170638 +)
Downstram Exon
ENSMUSE00000395804 (Chr14:21170534..21170638 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCACGCTCTTAACCACCA Chr14:21170547..21170566 60.83 50 TTCCATGGCTGTTGTTGGTA Chr14:21170622..21170641 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000706714 Chr14:21167384..21167616 GAGTGGGAACTCTGGGAGGT Chr14:21167400..21167419 60.5 60
upstream ENSMUSE00000713590 Chr14:21167444..21167616 CCGCAGAGGAGAAAAAGGAG Chr14:21167549..21167568 61.38 55
upstream ENSMUSE00000720663 Chr14:21167444..21167616 CCGCAGAGGAGAAAAAGGAG Chr14:21167549..21167568 61.38 55

*** Putative Vector Insertion (Chr 14: 21170533 - 21170639) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000395804 Chr14:21170534..21170638 TTCCATGGCTGTTGTTGGTA Chr14:21170622..21170641 59.96 45
downstream ENSMUSE00000564512 Chr14:21170534..21170638 TTCCATGGCTGTTGTTGGTA Chr14:21170622..21170641 59.96 45
downstream ENSMUSE00000238014 Chr14:21171926..21172061 AATGGGTGATTCTTGGGTGA Chr14:21171959..21171978 60.17 45
downstream ENSMUSE00000238004 Chr14:21175577..21175719 CTCAGTGGCATTCTGGTCAA Chr14:21175603..21175622 59.83 50
downstream ENSMUSE00000237997 Chr14:21177246..21177362 CGAGGGTACAATCCATAGCC Chr14:21177302..21177321 59.41 55
downstream ENSMUSE00000237993 Chr14:21178977..21179138 TCCTCGATTACCCCTTCAGA Chr14:21179114..21179133 59.62 50
downstream ENSMUSE00000498331 Chr14:21182485..21182672 TGACTACGCGTCAACTGCTC Chr14:21182655..21182674 60.21 55
downstream ENSMUSE00000706713 Chr14:21182485..21184460 AGAAAGGGTTCCCGTGACTT Chr14:21183299..21183318 59.97 50
downstream ENSMUSE00000342312 Chr14:21187068..21187186 TGTTCTCATTCGGCCTCTTC Chr14:21187091..21187110 60.34 50
downstream ENSMUSE00000564503 Chr14:21193552..21193676 CAAAGGATGCTGTTCGTTCA Chr14:21193628..21193647 59.84 45
downstream ENSMUSE00000564502 Chr14:21194732..21194835 ATCAAGAGGCCACTCACGTT Chr14:21194787..21194806 59.73 50
downstream ENSMUSE00000564501 Chr14:21196997..21197221 GATCGGATGAAGGGTACGTG Chr14:21197159..21197178 60.34 55
downstream ENSMUSE00000564498 Chr14:21197622..21197745 GGCGCTCAGGTGTTCTACTT Chr14:21197727..21197746 59.5 55
downstream ENSMUSE00000564497 Chr14:21197986..21198105 TCGTCTACCACTGCACTTCG Chr14:21198035..21198054 60.05 55
downstream ENSMUSE00000564495 Chr14:21200971..21201043 CTCAGATGCACATGAACTTCG Chr14:21201008..21201028 59.46 47.62
downstream ENSMUSE00000564494 Chr14:21202139..21202711 CTGCCCCATGGAGTAGGTTA Chr14:21202458..21202477 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCACGCTCTTAACCACCAC Chr14:21170549..21170569 60.32 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCACGCTCTTAACCACCAC Chr14:21170549..21170569 60.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039599