Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2806
Trapped Gene
Zfp30 (ENSMUSG00000047473)
Vector Insertion
Chr 7: 30571237 - 30571323
Public Clones AG0520 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000718006 (Chr7:30571238..30571322 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAAGCCAGTTCTTGCGATT Chr7:30571286..30571305 59.88 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000718006 (Chr7:30571238..30571322 +)
Downstram Exon
ENSMUSE00000722253 (Chr7:30571238..30571322 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAAGCCAGTTCTTGCGATT Chr7:30571286..30571305 59.88 45 AATCGCAAGAACTGGCTTGT Chr7:30571308..30571327 59.88 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710483 Chr7:30569103..30569920 TAGGCGCTCAAGGTCATTCT Chr7:30569745..30569764 59.98 50
upstream ENSMUSE00000597327 Chr7:30569808..30569920 AACAAGGCCTGGAGTGTCTG Chr7:30569837..30569856 60.3 55

*** Putative Vector Insertion (Chr 7: 30571237 - 30571323) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000718006 Chr7:30571238..30571322 AATCGCAAGAACTGGCTTGT Chr7:30571308..30571327 59.88 45
downstream ENSMUSE00000722253 Chr7:30571238..30571322 AATCGCAAGAACTGGCTTGT Chr7:30571308..30571327 59.88 45
downstream ENSMUSE00000200755 Chr7:30573068..30573194 CTCAGGCACTCCCACTCTTC Chr7:30573132..30573151 59.99 60
downstream ENSMUSE00000200760 Chr7:30574357..30574455 CCTTGTTCCAACAGGGTGAT Chr7:30574408..30574427 59.82 50
downstream ENSMUSE00000708734 Chr7:30574360..30574455 CCTTGTTCCAACAGGGTGAT Chr7:30574408..30574427 59.82 50
downstream ENSMUSE00000478306 Chr7:30577379..30579559 CTCGAAGGTCCGAGCTACAC Chr7:30577879..30577898 60.01 60
downstream ENSMUSE00000721891 Chr7:30577379..30579721 CTCGAAGGTCCGAGCTACAC Chr7:30577879..30577898 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGCCTCTGTGAACGGCTTC Chr7:30571242..30571262 60.54 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGCCTCTGTGAACGGCTTC Chr7:30571242..30571262 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047473