Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28081
Trapped Gene
Rims2 (ENSMUSG00000037386)
Vector Insertion
Chr 15: 39030085 - 39106521
Public Clones (sanger) (sanger) IST11203E4 (tigm) IST10875D3 (tigm) IST14853B7 (tigm)
IST12282D8 (tigm) IST11633A6 (tigm) IST14787G9 (tigm) IST12849G2 (tigm)
IST12180H4HMR1 (tigm) IST10503C11 (tigm) IST12786F5 (tigm) IST12037E10 (tigm)
IST15050D2 (tigm) IST10821E4 (tigm) IST14735A11 (tigm) IST10991G10 (tigm)
IST12345H10 (tigm) IST15050D2 (tigm) IST14948C12 (tigm) IST10520D7 (tigm)
IST12312H7 (tigm) IST14037H8 (tigm) IST10827A7 (tigm) IST11293H10 (tigm)
IST11678F2 (tigm) IST12637B5 (tigm) IST12392A12 (tigm) IST10037F6 (tigm)
IST10403H8 (tigm) IST12523F4BBF1 (tigm) IST14466B12 (tigm) IST10407H8 (tigm)
IST14504H5 (tigm) IST11724H6 (tigm) IST10874H10 (tigm) IST11833B5 (tigm)
IST10114G5 (tigm) IST12961D4 (tigm) IST14980F10 (tigm) IST12345H10 (tigm)
IST10991G10 (tigm) IST10762G5 (tigm) IST12757A1 (tigm) IST10012A11 (tigm)
IST10538F10 (tigm) IST10826G10 (tigm) IST11839C8 (tigm) IST13046F7 (tigm)
IST12510D4 (tigm) IST10648B5 (tigm) IST14176A4 (tigm) IST11161B9 (tigm)
IST10589G6 (tigm) IST10296A2 (tigm) IST11162G9 (tigm) IST14878D6 (tigm)
IST13982H11 (tigm)
Private Clones OST40380 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000508133 (Chr15:39029878..39030084 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGTCATGGATCGTCAGAA Chr15:39030032..39030051 59.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000508133 (Chr15:39029878..39030084 +)
Downstram Exon
ENSMUSE00000562094 (Chr15:39106522..39106554 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGTCATGGATCGTCAGAA Chr15:39030032..39030051 59.79 50 GTGTCGGTTGTGCTTTGTGT Chr15:39106556..39106575 59.65 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000508133 Chr15:39029878..39030084 GCTGTCATGGATCGTCAGAA Chr15:39030032..39030051 59.79 50

*** Putative Vector Insertion (Chr 15: 39030085 - 39106521) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000562094 Chr15:39106522..39106554 GTGTCGGTTGTGCTTTGTGT Chr15:39106556..39106575 59.65 50
downstream ENSMUSE00000562092 Chr15:39106960..39107046 TCATTGGGTTGTTTTTGCTG Chr15:39107034..39107053 59.56 40
downstream ENSMUSE00000474739 Chr15:39123648..39123858 CGAGCACAGAACTTGGTTTG Chr15:39123827..39123846 59.49 50
downstream ENSMUSE00000473739 Chr15:39176856..39177166 TCTTGTTGTTTTCGGCACAA Chr15:39176896..39176915 60.27 40
downstream ENSMUSE00000683481 Chr15:39223668..39223789 TTGCATTGTTCAGCGTTTGT Chr15:39223791..39223810 60.3 40
downstream ENSMUSE00000460906 Chr15:39268543..39269468 CCATTGCAGCTCTACGTTCA Chr15:39269060..39269079 60.01 50
downstream ENSMUSE00000562027 Chr15:39283586..39283653 CTCACTGCTATGCCAAGACG Chr15:39283638..39283657 59.62 55
downstream ENSMUSE00000562090 Chr15:39283770..39283978 TGCTCCTCGTTAAGGGTTGT Chr15:39283965..39283984 59.73 50
downstream ENSMUSE00000562089 Chr15:39285906..39286025 CCAATTAGGCGATCTCCATC Chr15:39285955..39285974 59.49 50
downstream ENSMUSE00000562088 Chr15:39288224..39288323 AATGCACAAAGTCGACCTGA Chr15:39288270..39288289 59.29 45
downstream ENSMUSE00000562086 Chr15:39289310..39289433 CTTGCAATAGCCTCCCATTC Chr15:39289351..39289370 59.67 50
downstream ENSMUSE00000562084 Chr15:39291135..39291181 GTGCATGCGTGCTATCAGGT Chr15:39291172..39291191 62.24 55
downstream ENSMUSE00000562083 Chr15:39294044..39294156 CAGATAAGAACTGCGGGACA Chr15:39294148..39294167 58.87 50
downstream ENSMUSE00000562080 Chr15:39303880..39304010 TGGTGACCAACCTTGTCAAA Chr15:39303914..39303933 59.98 45
downstream ENSMUSE00000562078 Chr15:39307926..39308097 GGAATTCTCTTCGGTGGACA Chr15:39308026..39308045 60.05 50
downstream ENSMUSE00000562076 Chr15:39310103..39310256 AGTGCGGCTCATCATCTAGC Chr15:39310151..39310170 60.53 55
downstream ENSMUSE00000562075 Chr15:39338512..39338580 CATCCTCGCAGTCGTAGTCA Chr15:39338565..39338584 60.01 55
downstream ENSMUSE00000562072 Chr15:39341191..39341347 CACTAGGCGACCATGACCTT Chr15:39341334..39341353 60.13 55
downstream ENSMUSE00000562070 Chr15:39342810..39342920 CCATTCGGCTAATTGTGTTG Chr15:39342877..39342896 59.04 45
downstream ENSMUSE00000562026 Chr15:39366384..39366563 CTCGATAAGGCAGGTGAAGG Chr15:39366566..39366585 59.83 55
downstream ENSMUSE00000562069 Chr15:39367418..39367527 TCCTGTTCCCGGAGTACTTG Chr15:39367478..39367497 60.1 55
downstream ENSMUSE00000562045 Chr15:39398489..39398589 TCATTTGGCGATTTCTCTCC Chr15:39398527..39398546 60.15 45
downstream ENSMUSE00000562064 Chr15:39417136..39417308 TTGGACGGACATGTAGCTTG Chr15:39417279..39417298 59.72 50
downstream ENSMUSE00000562023 Chr15:39441610..39441687 GAACTGGTGTCTGTGCTCCA Chr15:39441656..39441675 59.87 55
downstream ENSMUSE00000562061 Chr15:39447815..39448056 GCGACTTTTCCGTGAGAGAC Chr15:39448034..39448053 60 55
downstream ENSMUSE00000683479 Chr15:39491331..39491472 GCCAGCTAGAGCCTCAAAAG Chr15:39491435..39491454 59.36 55
downstream ENSMUSE00000229123 Chr15:39506486..39506627 TAGCTGTTCATGCTGCCATC Chr15:39506615..39506634 59.98 50
downstream ENSMUSE00000229120 Chr15:39510794..39510906 AGGCCATCCAGGAAATCACT Chr15:39510859..39510878 60.85 50
downstream ENSMUSE00000229114 Chr15:39511176..39511277 CCGGATGATTTCTACCTCCA Chr15:39511237..39511256 59.89 50
downstream ENSMUSE00000229108 Chr15:39512535..39512674 GGCTATGCAGACTCCGTTGT Chr15:39512584..39512603 60.28 55
downstream ENSMUSE00000562051 Chr15:39513092..39513486 CAGAGACGATTGGGAAGCTC Chr15:39513277..39513296 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGTGCACTGTGTCTCAT Chr15:39093036..39093056 58.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGCCTTGAGGAGTCACTG Chr15:39093078..39093098 59.12 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037386