Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28084
Trapped Gene
Pigq (ENSMUSG00000025728)
Vector Insertion
Chr 17: 26074408 - 26078759
Public Clones (sanger) (sanger)
Private Clones OST40319 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000337554 (Chr17:26078760..26078880 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAACCCAGTTCCTTCCCTA Chr17:26078792..26078811 61.23 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000337554 (Chr17:26078760..26078880 -)
Downstram Exon
ENSMUSE00000152630 (Chr17:26073709..26074407 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAACCCAGTTCCTTCCCTA Chr17:26078792..26078811 61.23 55 GGGTTAGACATCTGCGGGTA Chr17:26074026..26074045 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337554 Chr17:26078760..26078880 CCAACCCAGTTCCTTCCCTA Chr17:26078792..26078811 61.23 55

*** Putative Vector Insertion (Chr 17: 26074408 - 26078759) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000152630 Chr17:26073709..26074407 GGGTTAGACATCTGCGGGTA Chr17:26074026..26074045 59.96 55
downstream ENSMUSE00000152623 Chr17:26071948..26072079 GCTTTCTCCGTGCTGAAGAT Chr17:26071950..26071969 59.58 50
downstream ENSMUSE00000152626 Chr17:26071703..26071823 GCCACATCCAGTAGCACAGA Chr17:26071763..26071782 59.86 55
downstream ENSMUSE00000657993 Chr17:26071039..26071218 ACTTCCACGGAGACACTGCT Chr17:26071171..26071190 59.91 55
downstream ENSMUSE00000152631 Chr17:26069050..26069176 AGTGCCCGATTCATCTTGAG Chr17:26069078..26069097 60.22 50
downstream ENSMUSE00000152625 Chr17:26068619..26068772 AAGGGGGACATAAGGTGGAT Chr17:26068726..26068745 59.51 50
downstream ENSMUSE00000152629 Chr17:26068407..26068518 GAACAGACGCCAGAGAGAGG Chr17:26068448..26068467 60.13 60
downstream ENSMUSE00000152624 Chr17:26067903..26067983 GAAGAGCAAGGTCCCAATGA Chr17:26067938..26067957 60.19 50
downstream ENSMUSE00000152621 Chr17:26067466..26067580 GCAGGGAATTGATGAGGTCT Chr17:26067492..26067511 59.09 50
downstream ENSMUSE00000255675 Chr17:26065736..26065797 TGCCTCCTTTTCCAGAACTC Chr17:26065741..26065760 59.4 50
downstream ENSMUSE00000701525 Chr17:26063373..26064701 TCTGCGGAGGCTTATGAAGT Chr17:26063942..26063961 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATAATCGCCTTGCAGCACA Chr17:26075690..26075710 63.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCCAGTTCCTTCCCTACC Chr17:26078788..26078808 59.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTAATCGCCTTGCAGCACAT Chr17:26078811..26078831 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCGGAAATGGTGCTGATGTC Chr17:26078870..26078890 63.89 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025728