Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28088
Trapped Gene
Il2rg (ENSMUSG00000031304)
Vector Insertion
Chr X: 98457339 - 98457717
Public Clones not available
Private Clones OST40230 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000654393 (ChrX:98457718..98457786 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCATGCTGAAGAATCCAGA ChrX:98457732..98457751 61.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000654393 (ChrX:98457718..98457786 -)
Downstram Exon
ENSMUSE00000654391 (ChrX:98457172..98457338 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCATGCTGAAGAATCCAGA ChrX:98457732..98457751 61.15 50 GGAGACCTTGCTGGGAGATT ChrX:98457199..98457218 60.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709828 ChrX:98464292..98464362 GACCAGTTTGTGGGTTACGG ChrX:98464310..98464329 60.27 55
upstream ENSMUSE00000288853 ChrX:98463394..98463545 GTCCAGTGCGAATGAAGACA ChrX:98463403..98463422 59.84 50
upstream ENSMUSE00000208107 ChrX:98463050..98463203 TTCTACAGCCCCTGAACACC ChrX:98463171..98463190 60.11 55
upstream ENSMUSE00000208116 ChrX:98462650..98462834 CATTTGTTGTCCAGCTCCAG ChrX:98462705..98462724 59.29 50
upstream ENSMUSE00000208113 ChrX:98462317..98462459 GGAGCAACAGAGATCGAAGC ChrX:98462323..98462342 60.1 55
upstream ENSMUSE00000208105 ChrX:98461520..98461682 ACGGTACACATTTCGGGTTC ChrX:98461607..98461626 59.72 50
upstream ENSMUSE00000208115 ChrX:98460969..98461065 CTTATCCCTGTTGGCACCAT ChrX:98461014..98461033 59.81 50
upstream ENSMUSE00000208111 ChrX:98460715..98460781 No primer for this exon
upstream ENSMUSE00000720408 ChrX:98460304..98460376 GTGGTGTGTCTAAAGGGCTGA ChrX:98460349..98460369 60.16 52.38
upstream ENSMUSE00000444271 ChrX:98459726..98460376 GGGGCTAAGTTTCGATTTCC ChrX:98460068..98460087 59.91 50
upstream ENSMUSE00000654396 ChrX:98459164..98459331 ATGATCCATCAAGGGGTGAA ChrX:98459210..98459229 60.13 45
upstream ENSMUSE00000654395 ChrX:98458973..98459059 TCCAATTGCTCTGTCCTCCT ChrX:98459017..98459036 59.8 50
upstream ENSMUSE00000654394 ChrX:98458640..98458774 ATGAATCGGGAACCATGAAG ChrX:98458737..98458756 59.75 45
upstream ENSMUSE00000654393 ChrX:98457718..98457786 CCCATGCTGAAGAATCCAGA ChrX:98457732..98457751 61.15 50

*** Putative Vector Insertion (Chr X: 98457339 - 98457717) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000654391 ChrX:98457172..98457338 GGAGACCTTGCTGGGAGATT ChrX:98457199..98457218 60.6 55
downstream ENSMUSE00000709391 ChrX:98456744..98456836 AGGTGGTCCGTCTTCATCTG ChrX:98456779..98456798 60.11 55
downstream ENSMUSE00000654390 ChrX:98456716..98456836 AGGTGGTCCGTCTTCATCTG ChrX:98456779..98456798 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000031304