Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28095
Trapped Gene
Dctd (ENSMUSG00000031562)
Vector Insertion
Chr 8: 49197458 - 49222611
Public Clones not available
Private Clones OST40101 (lexicon)
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000210767 (Chr8:49197322..49197457 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGTTGGGATCGGGTACAAT Chr8:49197356..49197375 60.05 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000210767 (Chr8:49197322..49197457 +)
Downstram Exon
ENSMUSE00000210765 (Chr8:49222612..49222728 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGTTGGGATCGGGTACAAT Chr8:49197356..49197375 60.05 45 TTGTTCATGATGGCGTTCAG Chr8:49222648..49222667 60.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359191 Chr8:49195539..49195602 No primer for this exon
upstream ENSMUSE00000399702 Chr8:49197013..49197144 CAAAGAAGCAAGGACCCAAG Chr8:49197118..49197137 59.85 50
upstream ENSMUSE00000210767 Chr8:49197322..49197457 TTGTTGGGATCGGGTACAAT Chr8:49197356..49197375 60.05 45

*** Putative Vector Insertion (Chr 8: 49197458 - 49222611) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000210765 Chr8:49222612..49222728 TTGTTCATGATGGCGTTCAG Chr8:49222648..49222667 60.67 45
downstream ENSMUSE00000636947 Chr8:49223533..49223606 No primer for this exon
downstream ENSMUSE00000210773 Chr8:49224136..49224232 CTCCTCGCTGTCGTGGTATT Chr8:49224188..49224207 60.28 55
downstream ENSMUSE00000371021 Chr8:49225697..49227017 GACGGGTGAGAAGATTCCAA Chr8:49225968..49225987 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTTTAATCGCCTTGCAG Chr8:49197503..49197523 59.36 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTTAAAAACCGGGAACGTG Chr8:49197492..49197513 60.1 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031562