Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28102
Trapped Gene
Ric3 (ENSMUSG00000048330)
Vector Insertion
Chr 7: 116201524 - 116226676
Public Clones not available
Private Clones OST40017 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716278 (Chr7:116226677..116226836 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACTCCACGGTGCAGAGAGT Chr7:116226775..116226794 58.46 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716278 (Chr7:116226677..116226836 -)
Downstram Exon
ENSMUSE00000331684 (Chr7:116201297..116201523 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACTCCACGGTGCAGAGAGT Chr7:116226775..116226794 58.46 55 TGGTGTCTGACCATCTGAGG Chr7:116201437..116201456 59.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000338016 Chr7:116226677..116226838 TACTCCACGGTGCAGAGAGT Chr7:116226775..116226794 58.46 55
upstream ENSMUSE00000716278 Chr7:116226677..116226836 TACTCCACGGTGCAGAGAGT Chr7:116226775..116226794 58.46 55

*** Putative Vector Insertion (Chr 7: 116201524 - 116226676) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000331684 Chr7:116201297..116201523 TGGTGTCTGACCATCTGAGG Chr7:116201437..116201456 59.66 55
downstream ENSMUSE00000369596 Chr7:116200258..116200330 TTCCGATCCTCTGCAGTTTT Chr7:116200277..116200296 59.81 45
downstream ENSMUSE00000408075 Chr7:116197879..116197972 No primer for this exon
downstream ENSMUSE00000528113 Chr7:116191465..116191610 TTCTCGGAGCTGATGCAGTA Chr7:116191531..116191550 59.7 50
downstream ENSMUSE00000712933 Chr7:116191465..116191607 TTCTCGGAGCTGATGCAGTA Chr7:116191531..116191550 59.7 50
downstream ENSMUSE00000710671 Chr7:116181462..116182397 GGAAGCGCATGACTAGGAAG Chr7:116181711..116181730 59.98 55
downstream ENSMUSE00000589361 Chr7:116177839..116182397 ATGGCCTGGTTCCTGTAGTG Chr7:116178878..116178897 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTCCAGAGGTCGTTGCAC Chr7:116217653..116217673 60.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTCCAGAGGTCGTTGCAC Chr7:116217653..116217673 60.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048330