Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2811
Trapped Gene
5730446C15Rik (ENSMUSG00000047368)
Vector Insertion
Chr 19: 21728084 - 21752842
Public Clones AG0493 (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) D014H07 (ggtc) D144C09 (ggtc) D028D08 (ggtc)
IST11189B9 (tigm) IST13039B9 (tigm) IST12295D7 (tigm) IST14476F9 (tigm)
IST12387D5HMF1 (tigm) IST15058C2 (tigm) IST14663G4 (tigm) IST14885F7 (tigm)
IST14331A3 (tigm)
Private Clones OST467701 (lexicon) OST467474 (lexicon) OST464068 (lexicon) OST454931 (lexicon)
OST430239 (lexicon) OST402440 (lexicon) OST390725 (lexicon) OST323637 (lexicon)
OST318815 (lexicon) OST315156 (lexicon) OST310570 (lexicon) OST303464 (lexicon)
OST274795 (lexicon) OST274295 (lexicon) OST246252 (lexicon) OST237626 (lexicon)
OST230394 (lexicon) OST215988 (lexicon) OST205239 (lexicon) OST200448 (lexicon)
OST190971 (lexicon) OST190465 (lexicon) OST187944 (lexicon) OST179911 (lexicon)
OST174870 (lexicon) OST173997 (lexicon) OST166943 (lexicon) OST126910 (lexicon)
OST124820 (lexicon) OST85300 (lexicon) OST73084 (lexicon) OST56960 (lexicon)
OST55642 (lexicon) OST54639 (lexicon) OST45478 (lexicon) OST43645 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000448168 (Chr19:21727799..21728083 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGCCGTTAGTCAGCAGAA Chr19:21727915..21727934 60.54 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000448168 (Chr19:21727799..21728083 +)
Downstram Exon
ENSMUSE00000448149 (Chr19:21752843..21753312 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGCCGTTAGTCAGCAGAA Chr19:21727915..21727934 60.54 55 GGTGAACAACGCACAAACAT Chr19:21753111..21753130 59.47 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000448168 Chr19:21727799..21728083 GGAGCCGTTAGTCAGCAGAA Chr19:21727915..21727934 60.54 55

*** Putative Vector Insertion (Chr 19: 21728084 - 21752842) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000448149 Chr19:21752843..21753312 GGTGAACAACGCACAAACAT Chr19:21753111..21753130 59.47 45
downstream ENSMUSE00000394180 Chr19:21755358..21755537 GATGGCACTGTCCCTATGCT Chr19:21755420..21755439 60.1 55
downstream ENSMUSE00000381618 Chr19:21758588..21760127 CTCCACGTCATTGTGTCCTG Chr19:21758747..21758766 60.15 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCAGAGCTGTAGGTCGAA Chr19:21743098..21743118 59.34 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAATCGTGACTGGGAAAACC Chr19:21743130..21743151 58.94 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047368