Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28131
Trapped Gene
Dhx30 (ENSMUSG00000032480)
Vector Insertion
Chr 9: 109990771 - 109991056
Public Clones not available
Private Clones OST39076 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219975 (Chr9:109991057..109991209 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGAACAATGAGCCGCTTAC Chr9:109991172..109991191 59.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219975 (Chr9:109991057..109991209 -)
Downstram Exon
ENSMUSE00000219983 (Chr9:109989934..109990770 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGAACAATGAGCCGCTTAC Chr9:109991172..109991191 59.34 50 CACATAGCGCTCCAATAGCA Chr9:109990413..109990432 60 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690106 Chr9:110019862..110019926 CACCGAGGCTTGTTTCACAT Chr9:110019874..110019893 61.1 50
upstream ENSMUSE00000395894 Chr9:110017995..110018086 CAGCCTCGTGATGAGGAATAG Chr9:110018060..110018080 59.85 52.38
upstream ENSMUSE00000711781 Chr9:110017540..110017665 GCATGGTGACTCCTGTCTGT Chr9:110017564..110017583 58.67 55
upstream ENSMUSE00000718544 Chr9:110017540..110017665 GCATGGTGACTCCTGTCTGT Chr9:110017564..110017583 58.67 55
upstream ENSMUSE00000398205 Chr9:110015475..110015529 CTCTCCTGGCCAGAAATGTT Chr9:110015498..110015517 59.28 50
upstream ENSMUSE00000529336 Chr9:110015475..110015594 CTCTCCTGGCCAGAAATGTT Chr9:110015498..110015517 59.28 50
upstream ENSMUSE00000346996 Chr9:110011530..110011625 TTCCACCCATGTGTGTCAAC Chr9:110011558..110011577 60.27 50
upstream ENSMUSE00000311417 Chr9:110003320..110003530 AAGCTTTGTCCGCTCTGATG Chr9:110003398..110003417 60.54 50
upstream ENSMUSE00000219974 Chr9:110001233..110001363 TCTCAACAGCGTGATTGGAA Chr9:110001301..110001320 60.39 45
upstream ENSMUSE00000311372 Chr9:109999593..109999703 TGGCAGCAAGAAGATTGATG Chr9:109999634..109999653 59.95 45
upstream ENSMUSE00000219988 Chr9:109995362..109995663 ACCGAGTGCTAGCTGATCGT Chr9:109995595..109995614 60.04 55
upstream ENSMUSE00000219991 Chr9:109994820..109994940 TCAGATTGCAACCTCCTCCT Chr9:109994831..109994850 59.8 50
upstream ENSMUSE00000219977 Chr9:109993923..109994072 CCTGTCCCATGACCTTTGTT Chr9:109993989..109994008 59.82 50
upstream ENSMUSE00000219975 Chr9:109991057..109991209 AGGAACAATGAGCCGCTTAC Chr9:109991172..109991191 59.34 50

*** Putative Vector Insertion (Chr 9: 109990771 - 109991056) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219983 Chr9:109989934..109990770 CACATAGCGCTCCAATAGCA Chr9:109990413..109990432 60 50
downstream ENSMUSE00000436137 Chr9:109989624..109989699 GCAGAACCAGGTCAGTCACA Chr9:109989626..109989645 59.87 55
downstream ENSMUSE00000219992 Chr9:109989606..109989699 GCAGAACCAGGTCAGTCACA Chr9:109989626..109989645 59.87 55
downstream ENSMUSE00000219982 Chr9:109989436..109989540 GATTTCTTGCCAGCCAGGTA Chr9:109989481..109989500 60.21 50
downstream ENSMUSE00000436127 Chr9:109989035..109989210 AATCTTGCGTACCCCAAGTG Chr9:109989118..109989137 59.99 50
downstream ENSMUSE00000219987 Chr9:109988986..109989213 AATCTTGCGTACCCCAAGTG Chr9:109989118..109989137 59.99 50
downstream ENSMUSE00000219986 Chr9:109988624..109988830 CTCCTCGGGAACAAGTGGTA Chr9:109988702..109988721 60.1 55
downstream ENSMUSE00000219979 Chr9:109988454..109988535 AATCTCCTGGAGCAGGATCA Chr9:109988433..109988452 59.76 50
downstream ENSMUSE00000219972 Chr9:109988189..109988382 CAGTCGGGGGTCAGTAGAGA Chr9:109988287..109988306 60.25 60
downstream ENSMUSE00000529329 Chr9:109988189..109988379 CAGTCGGGGGTCAGTAGAGA Chr9:109988287..109988306 60.25 60
downstream ENSMUSE00000219984 Chr9:109987916..109988075 AGTTTTCCCTGGAGGTACGG Chr9:109987942..109987961 60.35 55
downstream ENSMUSE00000690080 Chr9:109987907..109988075 AGTTTTCCCTGGAGGTACGG Chr9:109987942..109987961 60.35 55
downstream ENSMUSE00000436115 Chr9:109987649..109987806 CTGGATGAGGTTGGGGTAGA Chr9:109987627..109987646 59.92 55
downstream ENSMUSE00000519887 Chr9:109987454..109987557 GAACTTGCCTTGCCGAGTAA Chr9:109987500..109987519 60.39 50
downstream ENSMUSE00000494213 Chr9:109987234..109987557 CTGGGAGGAATCTCGAACAA Chr9:109987263..109987282 60.19 50
downstream ENSMUSE00000219978 Chr9:109987233..109987372 GTCCCCATCTGTTAGGAGCA Chr9:109987224..109987243 60.07 55
downstream ENSMUSE00000501330 Chr9:109986825..109987150 GCTGTCTTGCGCATATCAAA Chr9:109986885..109986904 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGCCTTCCTGAGTCATGT Chr9:109991053..109991073 59.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGCCTTCCTGAGTCATGT Chr9:109991053..109991073 59.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032480