Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28136
Trapped Gene
Nup43 (ENSMUSG00000040034)
Vector Insertion
Chr 10: 7394956 - 7396037
Public Clones not available
Private Clones OST38939 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000374602 (Chr10:7394804..7394955 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAGGATGGAATGTTGAGT Chr10:7394875..7394894 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000374602 (Chr10:7394804..7394955 +)
Downstram Exon
ENSMUSE00000323066 (Chr10:7396038..7396160 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAGGATGGAATGTTGAGT Chr10:7394875..7394894 59.93 50 CCAATGCCAGAGAGATCCAT Chr10:7396117..7396136 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000323125 Chr10:7387342..7387479 CCTGCAGACCACAGAGACCT Chr10:7387434..7387453 60.46 60
upstream ENSMUSE00000355550 Chr10:7387800..7387922 GATTCTGACGGAGGGTTTGA Chr10:7387845..7387864 60.05 50
upstream ENSMUSE00000323106 Chr10:7389351..7389428 TTGTAGCTGCTTCGTCAACAG Chr10:7389370..7389390 59.28 47.62
upstream ENSMUSE00000323097 Chr10:7390737..7390917 CTGTCCGTCAATCAGCAGTG Chr10:7390740..7390759 60.46 55
upstream ENSMUSE00000348903 Chr10:7393383..7393518 GCAGTACACTCCATGCCGTA Chr10:7393395..7393414 59.75 55
upstream ENSMUSE00000374602 Chr10:7394804..7394955 GCCAGGATGGAATGTTGAGT Chr10:7394875..7394894 59.93 50

*** Putative Vector Insertion (Chr 10: 7394956 - 7396037) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000323066 Chr10:7396038..7396160 CCAATGCCAGAGAGATCCAT Chr10:7396117..7396136 60.03 50
downstream ENSMUSE00000323055 Chr10:7398366..7398675 GACAGAGTCCTGCTGGGAAG Chr10:7398510..7398529 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTACCATGCCTGTGTCA Chr10:7394912..7394932 59.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTACCATGCCTGTGTCA Chr10:7394912..7394932 59.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040034