Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2815
Trapped Gene
Ano10 (ENSMUSG00000037949)
Vector Insertion
Chr 9: 122085597 - 122110888
Public Clones AG0465 (sanger) CMHD-GT_118H3-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000256327 (Chr9:122110889..122111005 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATACTCGCATTTGCCATC Chr9:122110964..122110983 59.65 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000256327 (Chr9:122110889..122111005 -)
Downstram Exon
ENSMUSE00000365277 (Chr9:122084997..122085596 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATACTCGCATTTGCCATC Chr9:122110964..122110983 59.65 45 CCAGCATCAGGGCTAAGTTC Chr9:122085410..122085429 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711725 Chr9:122203422..122203492 No primer for this exon
upstream ENSMUSE00000715836 Chr9:122203422..122203492 No primer for this exon
upstream ENSMUSE00000446141 Chr9:122184629..122184781 TAGAACTCGCCCAGGATGTC Chr9:122184687..122184706 60.22 55
upstream ENSMUSE00000688078 Chr9:122184629..122184781 TAGAACTCGCCCAGGATGTC Chr9:122184687..122184706 60.22 55
upstream ENSMUSE00000446126 Chr9:122181485..122181682 AAGCAGTCGGTCTGGTGAAG Chr9:122181552..122181571 60.44 55
upstream ENSMUSE00000446094 Chr9:122180317..122180451 CACCATGGCTGAGTGTCAGT Chr9:122180413..122180432 59.74 55
upstream ENSMUSE00000446088 Chr9:122172788..122172907 CACGTGGTACACTCGGTTTG Chr9:122172809..122172828 60.06 55
upstream ENSMUSE00000409525 Chr9:122170202..122170771 GCATTGTTTATGCCGTTGTG Chr9:122170257..122170276 60 45
upstream ENSMUSE00000256122 Chr9:122168653..122168708 TGCCTACCAGAATCATCTCG Chr9:122168670..122168689 58.82 50
upstream ENSMUSE00000256099 Chr9:122168035..122168109 ATTGCTTCGCCTCACTCTTC Chr9:122168077..122168096 59.58 50
upstream ENSMUSE00000256073 Chr9:122166174..122166356 CCTCCCAGATTCTGAACCAA Chr9:122166315..122166334 60.04 50
upstream ENSMUSE00000393999 Chr9:122162054..122162245 CCTGCAGTTTGGCTATGTGA Chr9:122162197..122162216 59.86 50
upstream ENSMUSE00000256345 Chr9:122160265..122160393 TCCGTGGTCACTAACTGTGC Chr9:122160347..122160366 59.75 55
upstream ENSMUSE00000688076 Chr9:122157968..122158009 GGGATTACAAGCGAGCTTCA Chr9:122157985..122158004 60.35 50
upstream ENSMUSE00000256327 Chr9:122110889..122111005 TCATACTCGCATTTGCCATC Chr9:122110964..122110983 59.65 45

*** Putative Vector Insertion (Chr 9: 122085597 - 122110888) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000365277 Chr9:122084997..122085596 CCAGCATCAGGGCTAAGTTC Chr9:122085410..122085429 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCCCTGCGTTTACTGTGTA Chr9:122086905..122086925 61.08 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCCTGCGTTTACTGTGTA Chr9:122086905..122086925 61.08 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037949