Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28193
Trapped Gene
AC121959.3 (ENSMUSG00000070443)
Vector Insertion
Chr 3: 78722276 - 78722332
Public Clones not available
Private Clones OST37626 (lexicon) OST32922 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000590613 (Chr3:78721107..78722275 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGCAAAGTGGAGGTTGTT Chr3:78721247..78721266 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000590613 (Chr3:78721107..78722275 +)
Downstram Exon
ENSMUSE00000674383 (Chr3:78722333..78722380 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGCAAAGTGGAGGTTGTT Chr3:78721247..78721266 60.01 50 GGGTGCAGCGAACTTTATTG Chr3:78722383..78722402 60.64 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000590613 Chr3:78721107..78722275 GTGGCAAAGTGGAGGTTGTT Chr3:78721247..78721266 60.01 50

*** Putative Vector Insertion (Chr 3: 78722276 - 78722332) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674383 Chr3:78722333..78722380 GGGTGCAGCGAACTTTATTG Chr3:78722383..78722402 60.64 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCAGACCCCCATAATAACA Chr3:78722301..78722321 59.5 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCAGACCCCCATAATAACA Chr3:78722301..78722321 59.5 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070443