Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28198
Trapped Gene
Slc25a44 (ENSMUSG00000050144)
Vector Insertion
Chr 3: 88225061 - 88228649
Public Clones not available
Private Clones OST37469 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000712761 (Chr3:88228650..88229061 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGAGAAGGAAAGCGACCAC Chr3:88228895..88228914 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000712761 (Chr3:88228650..88229061 -)
Downstram Exon
ENSMUSE00000673519 (Chr3:88224423..88225060 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGAGAAGGAAAGCGACCAC Chr3:88228895..88228914 59.99 55 CTGGATGTTCCGTTTGTCCT Chr3:88225002..88225021 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712761 Chr3:88228650..88229061 CTGAGAAGGAAAGCGACCAC Chr3:88228895..88228914 59.99 55
upstream ENSMUSE00000720948 Chr3:88228650..88229061 CTGAGAAGGAAAGCGACCAC Chr3:88228895..88228914 59.99 55

*** Putative Vector Insertion (Chr 3: 88225061 - 88228649) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000360770 Chr3:88224423..88225060 CTGGATGTTCCGTTTGTCCT Chr3:88225002..88225021 59.97 50
downstream ENSMUSE00000673519 Chr3:88224423..88225060 CTGGATGTTCCGTTTGTCCT Chr3:88225002..88225021 59.97 50
downstream ENSMUSE00000673518 Chr3:88223964..88223973 No primer for this exon
downstream ENSMUSE00000673517 Chr3:88223759..88223771 No primer for this exon
downstream ENSMUSE00000673516 Chr3:88222291..88222304 No primer for this exon
downstream ENSMUSE00000673515 Chr3:88220867..88220871 No primer for this exon
downstream ENSMUSE00000363585 Chr3:88219910..88220037 GACAATGTGAGGGCACTCCT Chr3:88219972..88219991 60.12 55
downstream ENSMUSE00000673514 Chr3:88219908..88220011 ACATCCATGGGATTGGTGAG Chr3:88219907..88219926 60.6 50
downstream ENSMUSE00000403490 Chr3:88214421..88216819 GCAGAGCTGTCCAATCACAA Chr3:88214876..88214895 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATAATCGCCTTGCAGCAC Chr3:88225581..88225601 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGACGTGACTGGGAAAACC Chr3:88225582..88225602 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050144