Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28199
Trapped Gene
Arl8b (ENSMUSG00000030105)
Vector Insertion
Chr 6: 108765052 - 108765251
Public Clones not available
Private Clones OST37466 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000195334 (Chr6:108764978..108765051 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTACTGCCGAGGAGTCAAT Chr6:108765024..108765043 59.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000195334 (Chr6:108764978..108765051 +)
Downstram Exon
ENSMUSE00000195338 (Chr6:108765252..108765345 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTACTGCCGAGGAGTCAAT Chr6:108765024..108765043 59.17 55 CTCGATCTGCAGCATCTATCA Chr6:108765279..108765299 59.14 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000420475 Chr6:108733076..108733371 AAAGAGTGTCCGCTGTCGTC Chr6:108733196..108733215 60.45 55
upstream ENSMUSE00000195339 Chr6:108763621..108763701 CACAGTGGGCTTCAACATGA Chr6:108763650..108763669 60.72 50
upstream ENSMUSE00000195334 Chr6:108764978..108765051 GGTACTGCCGAGGAGTCAAT Chr6:108765024..108765043 59.17 55

*** Putative Vector Insertion (Chr 6: 108765052 - 108765251) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000195338 Chr6:108765252..108765345 CTCGATCTGCAGCATCTATCA Chr6:108765279..108765299 59.14 47.62
downstream ENSMUSE00000195335 Chr6:108768239..108768306 TGTTTCTCATCCAAGGCATTT Chr6:108768293..108768313 59.56 38.1
downstream ENSMUSE00000556633 Chr6:108768537..108768607 No primer for this exon
downstream ENSMUSE00000420470 Chr6:108771497..108773542 CTTATGCAGTCCCCGCTTAG Chr6:108773305..108773324 59.86 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTAATCGCCTTGCAGCAC Chr6:108765100..108765120 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTTGTTGTTTCGCTTTGG Chr6:108765070..108765090 59.75 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030105