Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28202
Trapped Gene
Nt5dc2 (ENSMUSG00000071547)
Vector Insertion
Chr 14: 31948291 - 31948523
Public Clones not available
Private Clones OST37406 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000562679 (Chr14:31948216..31948290 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGGATCCGGAAGTATGAC Chr14:31948223..31948242 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000562679 (Chr14:31948216..31948290 +)
Downstram Exon
ENSMUSE00000381406 (Chr14:31948524..31948579 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGGATCCGGAAGTATGAC Chr14:31948223..31948242 60.15 55 GTAGGCCGTTCCCAGTTGTA Chr14:31948580..31948599 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000618796 Chr14:31948039..31948109 CCGGGACATCTTGATAGAGC Chr14:31948082..31948101 59.65 55
upstream ENSMUSE00000562679 Chr14:31948216..31948290 AGGGGATCCGGAAGTATGAC Chr14:31948223..31948242 60.15 55

*** Putative Vector Insertion (Chr 14: 31948291 - 31948523) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000381406 Chr14:31948524..31948579 GTAGGCCGTTCCCAGTTGTA Chr14:31948580..31948599 59.99 55
downstream ENSMUSE00000237309 Chr14:31948680..31948773 AGAAGCCGCTCATCTGGTAG Chr14:31948768..31948787 59.6 55
downstream ENSMUSE00000237302 Chr14:31948872..31949000 CTCTGGGAGCGAGAAGATGT Chr14:31948919..31948938 59.56 55
downstream ENSMUSE00000237296 Chr14:31949104..31949164 ATGAGGCCCTTTACATGCAC Chr14:31949141..31949160 59.96 50
downstream ENSMUSE00000237290 Chr14:31949251..31949353 ACCGCAAATGTCTCATCTCC Chr14:31949290..31949309 60.08 50
downstream ENSMUSE00000237367 Chr14:31949454..31949555 CCTGTCGGTGAAAAAGTTGG Chr14:31949553..31949572 60.52 50
downstream ENSMUSE00000237355 Chr14:31949782..31949863 AGTGATACGGTCCCAGTGGA Chr14:31949836..31949855 60.39 55
downstream ENSMUSE00000618795 Chr14:31951310..31951396 TCACCGAAGTAGAGCACACG Chr14:31951377..31951396 60.05 55
downstream ENSMUSE00000618794 Chr14:31951518..31951658 ACTGCTCCGTGTTGATGATG Chr14:31951605..31951624 59.71 50
downstream ENSMUSE00000618793 Chr14:31951795..31951859 TTCATCCAGGTAGCCAGCAC Chr14:31951844..31951863 61.21 55
downstream ENSMUSE00000562663 Chr14:31951967..31952307 GAATAGGGCCTTTGTGATGC Chr14:31951991..31952010 59.53 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCCCTCCTGACTAGATGTG Chr14:31948315..31948335 59.53 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCCCTCCTGACTAGATGTG Chr14:31948315..31948335 59.53 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071547