Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28209
Trapped Gene
Wdr26 (ENSMUSG00000038733)
Vector Insertion
Chr 1: 183139444 - 183141206
Public Clones not available
Private Clones OST37148 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000386186 (Chr1:183141207..183141501 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTCATAGGACAGCACCTC Chr1:183141224..183141243 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000386186 (Chr1:183141207..183141501 -)
Downstram Exon
ENSMUSE00000342712 (Chr1:183139344..183139443 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTCATAGGACAGCACCTC Chr1:183141224..183141243 59.83 60 CGGAATTTGGTAGCAGAAGG Chr1:183139353..183139372 59.7 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000386186 Chr1:183141207..183141501 GGCTCATAGGACAGCACCTC Chr1:183141224..183141243 59.83 60
upstream ENSMUSE00000686554 Chr1:183141207..183141568 GGCTCATAGGACAGCACCTC Chr1:183141224..183141243 59.83 60

*** Putative Vector Insertion (Chr 1: 183139444 - 183141206) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000342712 Chr1:183139344..183139443 CGGAATTTGGTAGCAGAAGG Chr1:183139353..183139372 59.7 50
downstream ENSMUSE00000686553 Chr1:183139344..183139443 CGGAATTTGGTAGCAGAAGG Chr1:183139353..183139372 59.7 50
downstream ENSMUSE00000374390 Chr1:183139134..183139238 AGTGCGCCTCTTACCACAAT Chr1:183139146..183139165 59.76 50
downstream ENSMUSE00000349780 Chr1:183133155..183133291 TTCGCAGCGTAGAACTTGAA Chr1:183133180..183133199 59.75 45
downstream ENSMUSE00000381350 Chr1:183128978..183129075 AGCTTTTGCCCGTAGGTCTT Chr1:183129011..183129030 60.26 50
downstream ENSMUSE00000305738 Chr1:183127706..183127862 TAGGCACCGATCCCTTTGTA Chr1:183127752..183127771 60.46 50
downstream ENSMUSE00000305735 Chr1:183121892..183122030 No primer for this exon
downstream ENSMUSE00000305732 Chr1:183117737..183117877 TCTGGACCACAAGCAACAAG Chr1:183117749..183117768 59.87 50
downstream ENSMUSE00000305726 Chr1:183116079..183116198 GTCACAAAGCGTTTCCCATC Chr1:183116088..183116107 60.5 50
downstream ENSMUSE00000305719 Chr1:183114382..183114527 GTCCAGAAGATTTCCGTCCA Chr1:183114482..183114501 60.05 50
downstream ENSMUSE00000305709 Chr1:183113858..183113936 CAAAGCTAATCGGCCATTTT Chr1:183113854..183113873 59.21 40
downstream ENSMUSE00000305702 Chr1:183112900..183113029 CCTCCAAAACACGAGTGGAT Chr1:183112913..183112932 59.97 50
downstream ENSMUSE00000305695 Chr1:183111435..183111620 TGTGGGTTCCAGCTAACACA Chr1:183111502..183111521 60.15 50
downstream ENSMUSE00000686523 Chr1:183107824..183107962 CGAGCATGTCTGTCCAGCTA Chr1:183107807..183107826 60.16 55
downstream ENSMUSE00000340134 Chr1:183107492..183107962 TAGACGCGCTTCATCAACTG Chr1:183107712..183107731 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTCATAGGACAGCACCTC Chr1:183141222..183141242 59.83 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTCATAGGACAGCACCTC Chr1:183141222..183141242 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038733