Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28213
Trapped Gene
Usp49 (ENSMUSG00000023984)
Vector Insertion
Chr 17: 47811870 - 47815792
Public Clones CMHD-GT_388D1-3 (cmhd)
Private Clones OST36885 (lexicon)
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000319461 (Chr17:47811665..47811869 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGAGCCCTTTTGGGATCT Chr17:47811701..47811720 59.9 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000319461 (Chr17:47811665..47811869 +)
Downstram Exon
ENSMUSE00000136947 (Chr17:47815793..47815901 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGAGCCCTTTTGGGATCT Chr17:47811701..47811720 59.9 45 TTTAAGGTGTAGCCGGAGGA Chr17:47815896..47815915 59.7 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000497657 Chr17:47767639..47767864 CAGGAGTGGGAAACGAATGT Chr17:47767742..47767761 59.97 50
upstream ENSMUSE00000503992 Chr17:47786899..47786972 GGAAACCCAGCCAGTGATAA Chr17:47786912..47786931 59.93 50
upstream ENSMUSE00000136950 Chr17:47808993..47810367 GTGCAAGGACTACGTGCTCA Chr17:47809254..47809273 60.06 55
upstream ENSMUSE00000319461 Chr17:47811665..47811869 ATTGAGCCCTTTTGGGATCT Chr17:47811701..47811720 59.9 45

*** Putative Vector Insertion (Chr 17: 47811870 - 47815792) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136947 Chr17:47815793..47815901 TTTAAGGTGTAGCCGGAGGA Chr17:47815896..47815915 59.7 50
downstream ENSMUSE00000450395 Chr17:47816613..47816818 GACCACTGCGGAGAGATCAT Chr17:47816757..47816776 60.23 55
downstream ENSMUSE00000319430 Chr17:47817631..47821015 AGGAGTGTCCACGGCATAAC Chr17:47818510..47818529 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATAATCGCCTTGCAGCACA Chr17:47811919..47811939 63.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGAGAATCTACGCTTGTG Chr17:47811839..47811859 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023984