Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28230
Trapped Gene
Pigu (ENSMUSG00000038383)
Vector Insertion
Chr 2: 155140336 - 155154316
Public Clones IST12758C4 (tigm)
Private Clones OST36572 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000360863 (Chr2:155154317..155154417 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCTACCTGCGCCATCAAC Chr2:155154357..155154376 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000360863 (Chr2:155154317..155154417 -)
Downstram Exon
ENSMUSE00000403749 (Chr2:155140238..155140335 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCTACCTGCGCCATCAAC Chr2:155154357..155154376 60.28 55 AGAGAAGTCCTGGGGCAAAC Chr2:155140227..155140246 60.63 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000554532 Chr2:155183002..155183160 CAGTTTGGCCGAGTTCATTT Chr2:155183047..155183066 60.11 45
upstream ENSMUSE00000332445 Chr2:155171384..155171448 GCACTGTTGGATCTGGGAGT Chr2:155171415..155171434 60.12 55
upstream ENSMUSE00000438469 Chr2:155162418..155162477 No primer for this exon
upstream ENSMUSE00000375530 Chr2:155161097..155161159 CCTCACTGCTATTGCCCTGT Chr2:155161129..155161148 60.28 55
upstream ENSMUSE00000339917 Chr2:155156885..155156994 AAATGCGCTACATCCCTCTG Chr2:155156899..155156918 60.24 50
upstream ENSMUSE00000360863 Chr2:155154317..155154417 AGTCTACCTGCGCCATCAAC Chr2:155154357..155154376 60.28 55

*** Putative Vector Insertion (Chr 2: 155140336 - 155154316) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000403749 Chr2:155140238..155140335 AGAGAAGTCCTGGGGCAAAC Chr2:155140227..155140246 60.63 55
downstream ENSMUSE00000326025 Chr2:155126937..155127091 CTCCCACGAGAAGATCCAGA Chr2:155127013..155127032 60.34 55
downstream ENSMUSE00000326015 Chr2:155124782..155124925 TGATCTGAAACACGCAGACA Chr2:155124800..155124819 58.95 45
downstream ENSMUSE00000503422 Chr2:155122819..155122943 CATCCCCCACAGTTGGATAG Chr2:155122845..155122864 60.19 55
downstream ENSMUSE00000411903 Chr2:155118426..155118568 GCCCAACATTGAAGGTCAGT Chr2:155118406..155118425 59.97 50
downstream ENSMUSE00000506147 Chr2:155103980..155104385 TCAAGTAGAGGCCGTGTGTG Chr2:155104291..155104310 59.9 55
downstream ENSMUSE00000639715 Chr2:155073242..155073334 CCTCCTTTTCGTCCTCTTTG Chr2:155073265..155073284 58.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCATCAACAACACCCTCAT Chr2:155154344..155154364 60.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCATCAACAACACCCTCAT Chr2:155154344..155154364 60.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCGACTCTGGTGTTTGCTTA Chr2:155154428..155154448 58.92 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTACCCGTGACTGGGAAAAC Chr2:155154352..155154372 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038383