Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28238
Trapped Gene
2010203O07Rik (ENSMUSG00000070972)
Vector Insertion
Chr 4: 59030541 - 59030695
Public Clones not available
Private Clones OST36283 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000632509 (Chr4:59030542..59030694 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGACGTTAGGGTGGTGATT Chr4:59030642..59030661 60.23 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000632509 (Chr4:59030542..59030694 +)
Downstram Exon
ENSMUSE00000673588 (Chr4:59030542..59030694 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGACGTTAGGGTGGTGATT Chr4:59030642..59030661 60.23 50 AATCACCACCCTAACGTCCA Chr4:59030664..59030683 60.23 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673593 Chr4:59016065..59016429 GCTACCACCCAGATCGCTAC Chr4:59016323..59016342 59.72 60
upstream ENSMUSE00000604298 Chr4:59016371..59016429 No primer for this exon

*** Putative Vector Insertion (Chr 4: 59030541 - 59030695) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000632509 Chr4:59030542..59030694 AATCACCACCCTAACGTCCA Chr4:59030664..59030683 60.23 50
downstream ENSMUSE00000673588 Chr4:59030542..59030694 AATCACCACCCTAACGTCCA Chr4:59030664..59030683 60.23 50
downstream ENSMUSE00000604304 Chr4:59032931..59033401 TCTCCTCCTCATCACGGATT Chr4:59033102..59033121 59.61 50
downstream ENSMUSE00000604296 Chr4:59035433..59035864 TCAGTCGTCCACAAAGGTCA Chr4:59035558..59035577 60.28 50
downstream ENSMUSE00000604303 Chr4:59035433..59038445 GCCCAAGCTCTCACATAAGC Chr4:59038109..59038128 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGGATCACCCAGAAGTA Chr4:59030574..59030594 59.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATCACCCAGAAGCGTGACT Chr4:59030579..59030599 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070972