Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28240
Trapped Gene
AC175032.1-202 (ENSMUSG00000048502)
Vector Insertion
Chr 14: 26803787 - 26806250
Public Clones not available
Private Clones OST36267 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000392052 (Chr14:26803632..26803786 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGAACTCGGCATCTCTGA Chr14:26803754..26803773 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000392052 (Chr14:26803632..26803786 +)
Downstram Exon
ENSMUSE00000370804 (Chr14:26806251..26806344 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGAACTCGGCATCTCTGA Chr14:26803754..26803773 59.95 50 GGTTTATCCTGCTCCTGCTC Chr14:26806342..26806361 58.89 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000619428 Chr14:26802491..26803031 CCAACAACTCATCTGCTCCA Chr14:26802654..26802673 59.83 50
upstream ENSMUSE00000392052 Chr14:26803632..26803786 AAGGAACTCGGCATCTCTGA Chr14:26803754..26803773 59.95 50

*** Putative Vector Insertion (Chr 14: 26803787 - 26806250) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000370804 Chr14:26806251..26806344 GGTTTATCCTGCTCCTGCTC Chr14:26806342..26806361 58.89 55
downstream ENSMUSE00000418920 Chr14:26806954..26807099 GAAGTGCGTTCTGCTCCTTC Chr14:26806988..26807007 60.14 55
downstream ENSMUSE00000650444 Chr14:26808245..26808880 TCTGACGGCCCTTAGAGAGA Chr14:26808461..26808480 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGCTTAATCGCCTTGCAG Chr14:26803832..26803852 59.63 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCTCGTGACTGGGAAAAC Chr14:26803833..26803853 59.33 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048502