Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28262
Trapped Gene
2010107G23Rik (ENSMUSG00000020083)
Vector Insertion
Chr 10: 61571872 - 61572631
Public Clones not available
Private Clones OST35791 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000643123 (Chr10:61572632..61572771 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000643123 (Chr10:61572632..61572771 -)
Downstram Exon
ENSMUSE00000643122 (Chr10:61570404..61571871 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643123 Chr10:61572632..61572771 No primer for this exon

*** Putative Vector Insertion (Chr 10: 61571872 - 61572631) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000643122 Chr10:61570404..61571871 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCCATCCTGAAGAGAAG Chr10:61572606..61572626 60.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCCATCCTGAAGAGAAG Chr10:61572606..61572626 60.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020083