Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28265
Trapped Gene
Gpbp1 (ENSMUSG00000032745)
Vector Insertion
Chr 13: 112223859 - 112226604
Public Clones not available
Private Clones OST35740 (lexicon)
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679708 (Chr13:112226605..112226792 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAATGCCTCGATGATTTCT Chr13:112226676..112226695 60.19 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679708 (Chr13:112226605..112226792 -)
Downstram Exon
ENSMUSE00000568902 (Chr13:112223756..112223858 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAATGCCTCGATGATTTCT Chr13:112226676..112226695 60.19 45 GGGAGCACATGTTTCATCATT Chr13:112223779..112223799 59.81 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000120497 Chr13:112279926..112280047 GGCAAAAGGGGATTATTCAA Chr13:112280000..112280019 58.88 40
upstream ENSMUSE00000610285 Chr13:112279926..112280236 GGGACTGAGACTGGTTGTGG Chr13:112280033..112280052 60.56 60
upstream ENSMUSE00000316427 Chr13:112277631..112278578 TGGTTGAATTTGGCGTATGA Chr13:112278558..112278577 59.93 40
upstream ENSMUSE00000706092 Chr13:112277631..112278123 TCTTGTGCAGTCCTTTTGGA Chr13:112277635..112277654 59.42 45
upstream ENSMUSE00000316419 Chr13:112257059..112257178 CATGAGGTGTTGAAGCCTTG Chr13:112257151..112257170 59.29 50
upstream ENSMUSE00000709405 Chr13:112257059..112257178 CATGAGGTGTTGAAGCCTTG Chr13:112257151..112257170 59.29 50
upstream ENSMUSE00000316480 Chr13:112243581..112243704 TGGCTTTGATTCTGGTATTGG Chr13:112243595..112243615 59.95 42.86
upstream ENSMUSE00000441336 Chr13:112243232..112243455 AAATTCCCGTTCTCGTAGCA Chr13:112243345..112243364 59.71 45
upstream ENSMUSE00000316470 Chr13:112239141..112239207 ATCTTTAGCTGCGGGTGTTT Chr13:112239144..112239163 58.86 45
upstream ENSMUSE00000316408 Chr13:112238104..112238163 CTACACGCCCAGACACACAC Chr13:112238142..112238161 60.23 60
upstream ENSMUSE00000369274 Chr13:112230840..112231024 CTGGATTCCCAGTAGCAGGA Chr13:112230927..112230946 60.21 55
upstream ENSMUSE00000316459 Chr13:112229312..112229452 TTTTAAGTCAACGGCCAAGAA Chr13:112229343..112229363 59.74 38.1
upstream ENSMUSE00000316453 Chr13:112228165..112228332 ATGCGCAGCGATAAAAAGAG Chr13:112228241..112228260 60.5 45
upstream ENSMUSE00000679708 Chr13:112226605..112226792 GCAATGCCTCGATGATTTCT Chr13:112226676..112226695 60.19 45

*** Putative Vector Insertion (Chr 13: 112223859 - 112226604) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568902 Chr13:112223756..112223858 GGGAGCACATGTTTCATCATT Chr13:112223779..112223799 59.81 42.86
downstream ENSMUSE00000679704 Chr13:112216369..112216859 ATGTTCAACACAGCCCAACA Chr13:112216501..112216520 60.01 45
downstream ENSMUSE00000610286 Chr13:112216140..112216859 CACTCTGCTCCGGTTTTAGC Chr13:112216158..112216177 60.01 55
downstream ENSMUSE00000568901 Chr13:112215890..112216859 CACTCTGCTCCGGTTTTAGC Chr13:112216158..112216177 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTAATCGCCTTGCAGCAC Chr13:112226536..112226556 61.26 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTCGTGACTGGGAAAACC Chr13:112226537..112226557 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032745