Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28280
Trapped Gene
1810029B16Rik (ENSMUSG00000025591)
Vector Insertion
Chr 8: 69000809 - 69001913
Public Clones not available
Private Clones OST35223 (lexicon)
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151986 (Chr8:69001914..69001956 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151986 (Chr8:69001914..69001956 -)
Downstram Exon
ENSMUSE00000636652 (Chr8:69000245..69000808 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCGCTTCTTAGGAACTGCAT Chr8:69000705..69000724 59.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000151988 Chr8:69010311..69010406 GAAGAAGCGGACTTGAGAGC Chr8:69010382..69010401 59.31 55
upstream ENSMUSE00000151987 Chr8:69007957..69008069 No primer for this exon
upstream ENSMUSE00000151985 Chr8:69006405..69006442 GCCTTGCGTCTCAACCTTAT Chr8:69006407..69006426 59.34 50
upstream ENSMUSE00000151991 Chr8:69005362..69005446 No primer for this exon
upstream ENSMUSE00000151989 Chr8:69004239..69004387 ACTTGGATCGGTTCAGCAGT Chr8:69004366..69004385 59.73 50
upstream ENSMUSE00000151986 Chr8:69001914..69001956 No primer for this exon

*** Putative Vector Insertion (Chr 8: 69000809 - 69001913) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636652 Chr8:69000245..69000808 GCGCTTCTTAGGAACTGCAT Chr8:69000705..69000724 59.62 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTGCAGACTTTCCGGTGA Chr8:69001908..69001928 61.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAATGAACAATGCAGAACG Chr8:69001860..69001881 59.72 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025591