Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28285
Trapped Gene
Oaz2 (ENSMUSG00000040652)
Vector Insertion
Chr 9: 65534079 - 65534079
Public Clones not available
Private Clones OST35005 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000409150 (Chr9:65534003..65534078 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTAAGTGTCCCCAGCTCCA Chr9:65534019..65534038 59.72 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000409150 (Chr9:65534003..65534078 +)
Downstram Exon
ENSMUSE00000346280 (Chr9:65534080..65534160 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTAAGTGTCCCCAGCTCCA Chr9:65534019..65534038 59.72 55 ATCTTCGACAGTGGGTGAGG Chr9:65534108..65534127 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000363133 Chr9:65524397..65524572 GAGCCACCGAGGATGATAAA Chr9:65524541..65524560 60.04 50
upstream ENSMUSE00000409150 Chr9:65534003..65534078 AGTAAGTGTCCCCAGCTCCA Chr9:65534019..65534038 59.72 55

*** Putative Vector Insertion (Chr 9: 65534079 - 65534079) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000346280 Chr9:65534080..65534160 ATCTTCGACAGTGGGTGAGG Chr9:65534108..65534127 60.11 55
downstream ENSMUSE00000246250 Chr9:65535605..65535780 GGAAGTGGACGATGTGAGGT Chr9:65535674..65535693 59.97 55
downstream ENSMUSE00000246230 Chr9:65536628..65536713 CCCTTCCTGAAGCAGATGAA Chr9:65536702..65536721 60.33 50
downstream ENSMUSE00000246214 Chr9:65536902..65538104 AGGCAAGAGCTCTGGTGGTA Chr9:65537775..65537794 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTGCTGCAGGCACATTGTT Chr9:65534039..65534059 61.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGTGGTGCTCCTCGTGAC Chr9:65534067..65534087 62.53 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040652