Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28290
Trapped Gene
5430437P03Rik (ENSMUSG00000031820)
Vector Insertion
Chr 8: 73921925 - 73922290
Public Clones (ggtc) (ggtc)
Private Clones OST34868 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000396414 (Chr8:73921578..73921924 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCGAACACCAAGGGTCAA Chr8:73921889..73921908 60.35 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000396414 (Chr8:73921578..73921924 +)
Downstram Exon
ENSMUSE00000213343 (Chr8:73922291..73922349 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCGAACACCAAGGGTCAA Chr8:73921889..73921908 60.35 45 CCTCCGAAAGATCCAGACAG Chr8:73922318..73922337 59.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000366419 Chr8:73920760..73920919 GTGTCGCCGTGGTCTAACTT Chr8:73920876..73920895 60.18 55
upstream ENSMUSE00000396414 Chr8:73921578..73921924 ATTCGAACACCAAGGGTCAA Chr8:73921889..73921908 60.35 45

*** Putative Vector Insertion (Chr 8: 73921925 - 73922290) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213343 Chr8:73922291..73922349 CCTCCGAAAGATCCAGACAG Chr8:73922318..73922337 59.8 55
downstream ENSMUSE00000221895 Chr8:73923425..73923545 CAAATTCGTGGCTCTTGTCA Chr8:73923516..73923535 59.84 45
downstream ENSMUSE00000392428 Chr8:73923628..73923706 CCGTCTCCAGGTCATACAGG Chr8:73923691..73923710 60.52 60
downstream ENSMUSE00000682507 Chr8:73925579..73925603 GCTGAAGAGGCCTTCCAAAT Chr8:73925601..73925620 60.71 50
downstream ENSMUSE00000221875 Chr8:73926645..73926774 GGGATGGTTTGCACATTCTC Chr8:73926695..73926714 60.33 50
downstream ENSMUSE00000213344 Chr8:73926875..73926961 CCTCAGTGCCATTGTGGATA Chr8:73926938..73926957 59.52 50
downstream ENSMUSE00000379280 Chr8:73928094..73928448 AATAGTGTGCCTGCGCTCTC Chr8:73928356..73928375 60.57 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTGGCTGGAGATGTAGGG Chr8:73921937..73921957 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTGGCTGGAGATGTAGGG Chr8:73921937..73921957 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031820