Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2830
Trapped Gene
Reep3 (ENSMUSG00000019873)
Vector Insertion
Chr 10: 66525820 - 66559537
Public Clones (sanger) AG0341 (sanger) E115G09 (ggtc) E139E07 (ggtc) E024H06 (ggtc)
E139E07 (ggtc) (ggtc) Ayu21-T26 (egtc) Ayu21-B135 (egtc) IST10919B1BBF1 (tigm)
IST14328G11 (tigm) IST14775G6 (tigm) IST10748C9 (tigm) IST14806A8 (tigm)
IST11980D6 (tigm) IST14281F4 (tigm) IST14990H10 (tigm) IST14641F5 (tigm)
IST10545H10 (tigm) IST13517A10 (tigm) IST10771C2 (tigm) IST12954B10 (tigm)
IST12737H5 (tigm) IST11221A1 (tigm) IST15052G11 (tigm) IST10748C9 (tigm)
IST11359G1 (tigm) IST13517H12 (tigm) IST14626G9 (tigm) IST14224E3 (tigm)
IST14418H10 (tigm) IST10677D6 (tigm) IST13047B12 (tigm) IST11016D11 (tigm)
IST12001F12 (tigm) IST10464E10 (tigm) IST14308E8 (tigm) IST14386G7 (tigm)
IST12099G4 (tigm) IST14368A12 (tigm) IST14700F4 (tigm) IST14245A1 (tigm)
IST11305E8 (tigm) IST14507F1 (tigm) IST11590E5 (tigm) IST12738D1 (tigm)
Private Clones OST466274 (lexicon) OST465928 (lexicon) OST448494 (lexicon) OST432315 (lexicon)
OST423514 (lexicon) OST410492 (lexicon) OST405727 (lexicon) OST370068 (lexicon)
OST338218 (lexicon) OST322860 (lexicon) OST316799 (lexicon) OST312731 (lexicon)
OST306622 (lexicon) OST302851 (lexicon) OST302045 (lexicon) OST285370 (lexicon)
OST274101 (lexicon) OST236327 (lexicon) OST189742 (lexicon) OST168735 (lexicon)
OST145418 (lexicon) OST117778 (lexicon) OST104987 (lexicon) OST104560 (lexicon)
OST82971 (lexicon) OST74960 (lexicon) OST65590 (lexicon) OST62841 (lexicon)
OST56744 (lexicon) OST51289 (lexicon) OST41502 (lexicon) OST39881 (lexicon)
OST39879 (lexicon) OST36295 (lexicon) OST34916 (lexicon) OST33195 (lexicon)
OST33193 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000575839 (Chr10:66559538..66559655 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000575839 (Chr10:66559538..66559655 -)
Downstram Exon
ENSMUSE00000575838 (Chr10:66525747..66525819 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000575839 Chr10:66559538..66559655 No primer for this exon

*** Putative Vector Insertion (Chr 10: 66525820 - 66559537) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000575838 Chr10:66525747..66525819 No primer for this exon
downstream ENSMUSE00000289962 Chr10:66502249..66502325 No primer for this exon
downstream ENSMUSE00000367558 Chr10:66498633..66498753 No primer for this exon
downstream ENSMUSE00000575837 Chr10:66497347..66497460 No primer for this exon
downstream ENSMUSE00000098748 Chr10:66484497..66484641 No primer for this exon
downstream ENSMUSE00000098747 Chr10:66477650..66477795 No primer for this exon
downstream ENSMUSE00000575834 Chr10:66476432..66476534 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCGACGAATATGGGAAGTG Chr10:66544506..66544526 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATCCGTGACTGGGAAAAC Chr10:66544471..66544491 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGAGGTTCCCGAGCAATAA Chr10:66544602..66544622 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCATTTTACGTGACTGGGAAA Chr10:66544592..66544613 58.13 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019873