Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28314
Trapped Gene
Wbp4 (ENSMUSG00000022023)
Vector Insertion
Chr 14: 79880253 - 79880737
Public Clones not available
Private Clones OST34205 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000447775 (Chr14:79880738..79881075 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATACCGACCCCACCTCTCA Chr14:79880939..79880958 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000447775 (Chr14:79880738..79881075 -)
Downstram Exon
ENSMUSE00000123036 (Chr14:79880180..79880252 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATACCGACCCCACCTCTCA Chr14:79880939..79880958 60.33 55 CCAGCACTTGCAGTAATCACA Chr14:79880176..79880196 59.92 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447775 Chr14:79880738..79881075 TATACCGACCCCACCTCTCA Chr14:79880939..79880958 60.33 55

*** Putative Vector Insertion (Chr 14: 79880253 - 79880737) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000123036 Chr14:79880180..79880252 CCAGCACTTGCAGTAATCACA Chr14:79880176..79880196 59.92 47.62
downstream ENSMUSE00000123034 Chr14:79876849..79876911 ATCCTCCTGGCCACATTTTC Chr14:79876834..79876853 61.22 50
downstream ENSMUSE00000123033 Chr14:79876610..79876739 ATCCTCTTGGTACGCCTTCA Chr14:79876619..79876638 59.69 50
downstream ENSMUSE00000123030 Chr14:79872159..79872332 GTGGGTTGGACAGTGCTGAT Chr14:79872262..79872281 61 55
downstream ENSMUSE00000123037 Chr14:79870494..79870540 CTGGCTTCTCCCATTGAGAT Chr14:79870498..79870517 59.24 50
downstream ENSMUSE00000123032 Chr14:79869912..79869987 No primer for this exon
downstream ENSMUSE00000123031 Chr14:79867080..79867270 AGGCCTCTCCAGCTTTCTTC Chr14:79867093..79867112 60.1 55
downstream ENSMUSE00000123029 Chr14:79865990..79866156 CTGGGCCAATTCTTTTCTCA Chr14:79866098..79866117 60.18 45
downstream ENSMUSE00000647202 Chr14:79859744..79861936 CTGGCAGACAAGAGGGTCTC Chr14:79860033..79860052 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTAATCGCCTTGCAGCAC Chr14:79880669..79880689 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGTCGTGACTGGGAAAAC Chr14:79880671..79880691 60.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022023