Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28337
Trapped Gene
Dhrs7b (ENSMUSG00000042569)
Vector Insertion
Chr 11: 60669355 - 60671219
Public Clones not available
Private Clones OST33523 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242367 (Chr11:60669202..60669354 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCAGGCATTCTTTGACTGT Chr11:60669223..60669242 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242367 (Chr11:60669202..60669354 +)
Downstram Exon
ENSMUSE00000391252 (Chr11:60671220..60671647 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCAGGCATTCTTTGACTGT Chr11:60669223..60669242 60.11 50 CATGGATGGCACAAAGTCTG Chr11:60671338..60671357 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677766 Chr11:60644181..60644233 GACCATGATCTCTCCGTCCT Chr11:60644210..60644229 59.06 55
upstream ENSMUSE00000242398 Chr11:60644189..60644233 GACCATGATCTCTCCGTCCT Chr11:60644210..60644229 59.06 55
upstream ENSMUSE00000242395 Chr11:60657667..60657845 CGCTCAAAGGCTTACCTGAG Chr11:60657779..60657798 60.15 55
upstream ENSMUSE00000677765 Chr11:60657667..60657845 CGCTCAAAGGCTTACCTGAG Chr11:60657779..60657798 60.15 55
upstream ENSMUSE00000242388 Chr11:60662603..60662706 TCCTCTGTGGACGAAATGTG Chr11:60662642..60662661 59.68 50
upstream ENSMUSE00000242379 Chr11:60665244..60665460 CAGTGCTTTGGCTATGTGGA Chr11:60665325..60665344 59.86 50
upstream ENSMUSE00000242373 Chr11:60665921..60666013 AGGGCAAGATCAGCATTCCT Chr11:60665981..60666000 61.13 50
upstream ENSMUSE00000242367 Chr11:60669202..60669354 CCCAGGCATTCTTTGACTGT Chr11:60669223..60669242 60.11 50

*** Putative Vector Insertion (Chr 11: 60669355 - 60671219) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391252 Chr11:60671220..60671647 CATGGATGGCACAAAGTCTG Chr11:60671338..60671357 60.11 50
downstream ENSMUSE00000677764 Chr11:60671220..60673697 CCAGTGCACCTCCTATGGTT Chr11:60672620..60672639 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGCTTCTCTCCTTCATCAG Chr11:60669363..60669383 60.09 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGCTTCTCTCCTTCATCAG Chr11:60669363..60669383 60.09 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042569