Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28339
Trapped Gene
D130003B22Rik (ENSMUSG00000024459)
Vector Insertion
Chr 17: 37126150 - 37126373
Public Clones (sanger) IST11822G4 (tigm) IST11759G3 (tigm) IST10173G11 (tigm)
Private Clones OST33507 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696612 (Chr17:37126374..37126449 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCGCTCTCTACCCTCCTA Chr17:37126420..37126439 59.73 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696612 (Chr17:37126374..37126449 -)
Downstram Exon
ENSMUSE00000696611 (Chr17:37125880..37126149 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCGCTCTCTACCCTCCTA Chr17:37126420..37126439 59.73 60 TTGACAGTCCTGGTCTGCTG Chr17:37125926..37125945 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696612 Chr17:37126374..37126449 CTGCGCTCTCTACCCTCCTA Chr17:37126420..37126439 59.73 60

*** Putative Vector Insertion (Chr 17: 37126150 - 37126373) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696611 Chr17:37125880..37126149 TTGACAGTCCTGGTCTGCTG Chr17:37125926..37125945 60.02 55
downstream ENSMUSE00000696609 Chr17:37125450..37125725 AGAAGGATTGCCTTTGCTCA Chr17:37125497..37125516 59.96 45
downstream ENSMUSE00000696606 Chr17:37124600..37124875 CCTGCAGGTCTGGTCTCAAT Chr17:37124691..37124710 60.26 55
downstream ENSMUSE00000696604 Chr17:37124361..37124468 GAAGCAGGCCAACAGTGATT Chr17:37124396..37124415 60.26 50
downstream ENSMUSE00000696602 Chr17:37121006..37122047 GAACAAGCATGTGGGAGGTT Chr17:37121169..37121188 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAGAGTGAGGGCATAATCG Chr17:37126316..37126337 60.6 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGTGAGGGCACGTGACTG Chr17:37126314..37126334 61.5 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTCCTATCCTTGCTGCTCA Chr17:37126405..37126425 60.49 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTCCTATCCTTGCTGCTCA Chr17:37126405..37126425 60.49 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024459