Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28343
Trapped Gene
Dkc1 (ENSMUSG00000031403)
Vector Insertion
Chr X: 72347905 - 72349678
Public Clones PST21699-NR (escells)
Private Clones OST33445 (lexicon)
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000209265 (ChrX:72347761..72347904 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGTTACTTGCGGCGTGTT ChrX:72347825..72347844 59.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000209265 (ChrX:72347761..72347904 +)
Downstram Exon
ENSMUSE00000209273 (ChrX:72349679..72349799 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGTTACTTGCGGCGTGTT ChrX:72347825..72347844 59.94 50 TGCAGATAGCTTCCCCCTTA ChrX:72349799..72349818 59.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000623372 ChrX:72341409..72341466 No primer for this exon
upstream ENSMUSE00000209261 ChrX:72342173..72342240 GACCGGAAGCCATTACAAGA ChrX:72342208..72342227 60.07 50
upstream ENSMUSE00000209270 ChrX:72342622..72342708 CACTTCTCAGTGGCCCTTGT ChrX:72342681..72342700 60.3 55
upstream ENSMUSE00000209274 ChrX:72343801..72343892 GAAGAGGGAGATTGGGGACT ChrX:72343866..72343885 59.49 55
upstream ENSMUSE00000209266 ChrX:72344102..72344286 AGCCACTCGTTTGGTGAAAT ChrX:72344252..72344271 59.6 45
upstream ENSMUSE00000209263 ChrX:72345369..72345433 TTGAAGGGGGTACTCAGCTTT ChrX:72345408..72345428 60.12 47.62
upstream ENSMUSE00000264784 ChrX:72345772..72345898 AAGAGGCAGCTTCGAGTGAG ChrX:72345829..72345848 59.89 55
upstream ENSMUSE00000209262 ChrX:72346329..72346459 GGCACCTACATTCGGACACT ChrX:72346355..72346374 60 55
upstream ENSMUSE00000209265 ChrX:72347761..72347904 AGAGTTACTTGCGGCGTGTT ChrX:72347825..72347844 59.94 50

*** Putative Vector Insertion (Chr X: 72347905 - 72349678) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000209273 ChrX:72349679..72349799 TGCAGATAGCTTCCCCCTTA ChrX:72349799..72349818 59.8 50
downstream ENSMUSE00000209267 ChrX:72350993..72351111 CCCACTTGCGAGGATAAGTG ChrX:72351100..72351119 60.65 55
downstream ENSMUSE00000209268 ChrX:72351617..72351720 GTGGCAGGGGTATTGTCTGT ChrX:72351696..72351715 59.85 55
downstream ENSMUSE00000209272 ChrX:72352511..72352589 TGAGGGGCTTGTACTGCTTC ChrX:72352561..72352580 60.4 55
downstream ENSMUSE00000551085 ChrX:72353518..72353643 TCCTTCAACTGGGGAACTGT ChrX:72353579..72353598 59.55 50
downstream ENSMUSE00000623371 ChrX:72354035..72355114 GTGGCAAAGGCCTGATTTTA ChrX:72354319..72354338 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000031403