Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28353
Trapped Gene
Rab11fip1 (ENSMUSG00000031488)
Vector Insertion
Chr 8: 28261276 - 28262068
Public Clones not available
Private Clones OST33118 (lexicon)
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000429989 (Chr8:28262069..28263631 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTGAAGCAGAATCGCAAA Chr8:28262211..28262230 60.13 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000429989 (Chr8:28262069..28263631 -)
Downstram Exon
ENSMUSE00000210014 (Chr8:28261167..28261275 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTGAAGCAGAATCGCAAA Chr8:28262211..28262230 60.13 45 TTGGTGGCTGTTGTGTTCAT Chr8:28261215..28261234 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000210016 Chr8:28284681..28285120 CAGGTGGGCAAGGAGAAGTA Chr8:28284903..28284922 60.25 55
upstream ENSMUSE00000210018 Chr8:28266699..28267141 TCGACAGTGACGATGAGTCC Chr8:28266895..28266914 59.83 55
upstream ENSMUSE00000210015 Chr8:28264618..28265407 CAACCGAACCAGTCCAACTT Chr8:28265353..28265372 60.01 50
upstream ENSMUSE00000429989 Chr8:28262069..28263631 CAGTGAAGCAGAATCGCAAA Chr8:28262211..28262230 60.13 45

*** Putative Vector Insertion (Chr 8: 28261276 - 28262068) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000210014 Chr8:28261167..28261275 TTGGTGGCTGTTGTGTTCAT Chr8:28261215..28261234 60.01 45
downstream ENSMUSE00000471152 Chr8:28249245..28253866 CCGTGTGTGTGTGTGTGTGT Chr8:28251728..28251747 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr8:28261999..28262019 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000031488