Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28369
Trapped Gene
Setd8 (ENSMUSG00000049327)
Vector Insertion
Chr 5: 124900890 - 124901294
Public Clones not available
Private Clones OST32618 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000322583 (Chr5:124900670..124900889 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTTATACGAAGCGCTGTGA Chr5:124900689..124900708 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000322583 (Chr5:124900670..124900889 +)
Downstram Exon
ENSMUSE00000322577 (Chr5:124901295..124901382 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTTATACGAAGCGCTGTGA Chr5:124900689..124900708 60.04 50 CTCCGCACAGGGTAGAAATC Chr5:124901354..124901373 59.69 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000426884 Chr5:124889939..124890024 No primer for this exon
upstream ENSMUSE00000687910 Chr5:124895502..124895737 No primer for this exon
upstream ENSMUSE00000649613 Chr5:124895548..124895583 No primer for this exon
upstream ENSMUSE00000649612 Chr5:124895586..124895672 No primer for this exon
upstream ENSMUSE00000649611 Chr5:124895675..124895737 No primer for this exon
upstream ENSMUSE00000398617 Chr5:124895978..124896093 No primer for this exon
upstream ENSMUSE00000384855 Chr5:124897223..124897379 TGCCTACATGAGTCCGAACA Chr5:124897255..124897274 60.26 50
upstream ENSMUSE00000322583 Chr5:124900670..124900889 CGTTATACGAAGCGCTGTGA Chr5:124900689..124900708 60.04 50

*** Putative Vector Insertion (Chr 5: 124900890 - 124901294) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000322577 Chr5:124901295..124901382 CTCCGCACAGGGTAGAAATC Chr5:124901354..124901373 59.69 55
downstream ENSMUSE00000322573 Chr5:124907068..124907127 CTTCCTTCCCGCTCTCAATC Chr5:124907119..124907138 61.23 55
downstream ENSMUSE00000322569 Chr5:124909784..124909974 ACTGCTTGGTAGCGATCACA Chr5:124909835..124909854 59.47 50
downstream ENSMUSE00000687911 Chr5:124910496..124910550 CTAGGCGGTTCGTTTCTTGA Chr5:124910531..124910550 60.38 50
downstream ENSMUSE00000351091 Chr5:124910497..124912316 CTTCGGTCCCCATAGTCGTA Chr5:124910670..124910689 59.95 55
downstream ENSMUSE00000649608 Chr5:124910497..124910892 GTGTGTGTGTGTGCGTGTGT Chr5:124910816..124910835 60.18 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCCCTCTCCTAACACCA Chr5:124900907..124900927 59.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCCCTCTCCTAACACCA Chr5:124900907..124900927 59.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049327