Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28386
Trapped Gene
H19 (ENSMUSG00000000031)
Vector Insertion
Chr 7: 149762020 - 149762107
Public Clones not available
Private Clones OST32355 (lexicon)
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000206405 (Chr7:149762108..149762235 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000206405 (Chr7:149762108..149762235 -)
Downstram Exon
ENSMUSE00000405412 (Chr7:149761437..149762019 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000631651 Chr7:149762734..149764022 No primer for this exon
upstream ENSMUSE00000206404 Chr7:149762518..149762652 No primer for this exon
upstream ENSMUSE00000206402 Chr7:149762314..149762435 No primer for this exon
upstream ENSMUSE00000206405 Chr7:149762108..149762235 No primer for this exon

*** Putative Vector Insertion (Chr 7: 149762020 - 149762107) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000405412 Chr7:149761437..149762019 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAATCTGCTCCAAGGTGA Chr7:149762102..149762122 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAATCTGCTCCAAGGTGA Chr7:149762102..149762122 59.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000031