Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28390
Trapped Gene
Nubp2 (ENSMUSG00000039183)
Vector Insertion
Chr 17: 25022563 - 25022663
Public Clones not available
Private Clones OST32208 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000299459 (Chr17:25022664..25022782 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCGACACATCATCCTTGT Chr17:25022743..25022762 59.56 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000299459 (Chr17:25022664..25022782 -)
Downstram Exon
ENSMUSE00000299434 (Chr17:25022364..25022562 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCGACACATCATCCTTGT Chr17:25022743..25022762 59.56 50 CCCCACAGACATAAGGGAGA Chr17:25022397..25022416 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000299481 Chr17:25023224..25023273 GCAACTAGTAGCGGAATGGAG Chr17:25023246..25023266 59.01 52.38
upstream ENSMUSE00000299459 Chr17:25022664..25022782 GTGCGACACATCATCCTTGT Chr17:25022743..25022762 59.56 50

*** Putative Vector Insertion (Chr 17: 25022563 - 25022663) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000299434 Chr17:25022364..25022562 CCCCACAGACATAAGGGAGA Chr17:25022397..25022416 59.92 55
downstream ENSMUSE00000299404 Chr17:25021346..25021500 GCCACGTCAGACACAAACTG Chr17:25021448..25021467 60.36 55
downstream ENSMUSE00000299374 Chr17:25021070..25021180 GCCTCACATCCCCAATAGAC Chr17:25021134..25021153 59.37 55
downstream ENSMUSE00000299350 Chr17:25020751..25020820 No primer for this exon
downstream ENSMUSE00000458656 Chr17:25019564..25020259 TCCTGTGCACAACTCTCTGG Chr17:25020112..25020131 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTCCTAATCGCCTTGCAG Chr17:25022598..25022618 61.91 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTTGACACCTGTTTCATTG Chr17:25022626..25022647 60.26 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039183