Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28391
Trapped Gene
Sepw1 (ENSMUSG00000041571)
Vector Insertion
Chr 7: 16505823 - 16507600
Public Clones not available
Private Clones OST32161 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000637142 (Chr7:16507601..16507720 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCTTGAGGTCCTTGTTGC Chr7:16507675..16507694 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000637142 (Chr7:16507601..16507720 -)
Downstram Exon
ENSMUSE00000637140 (Chr7:16505798..16505822 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCTTGAGGTCCTTGTTGC Chr7:16507675..16507694 60 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637142 Chr7:16507601..16507720 GAGCTTGAGGTCCTTGTTGC Chr7:16507675..16507694 60 55

*** Putative Vector Insertion (Chr 7: 16505823 - 16507600) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000637140 Chr7:16505798..16505822 No primer for this exon
downstream ENSMUSE00000637139 Chr7:16505654..16505707 TCCGGGGAACTCATGTTCTA Chr7:16505644..16505663 60.45 50
downstream ENSMUSE00000331484 Chr7:16505392..16505466 AACTTCCCGGCTACTGTCAC Chr7:16505386..16505405 59.21 55
downstream ENSMUSE00000408718 Chr7:16505197..16505295 TTTCCGGAACTTGCTCTCTG Chr7:16505232..16505251 60.51 50
downstream ENSMUSE00000637138 Chr7:16502559..16502888 GGAACATCGAGGAAAGACCA Chr7:16502775..16502794 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTGCAGTTCCCCCTTTTC Chr7:16507567..16507587 61 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTGCAGTTCCCCCTTTTC Chr7:16507567..16507587 61 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041571