Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28399
Trapped Gene
5330417C22Rik (ENSMUSG00000040412)
Vector Insertion
Chr 3: 108261387 - 108262602
Public Clones not available
Private Clones OST31948 (lexicon) OST31946 (lexicon) OST28445 (lexicon) OST24070 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000274917 (Chr3:108262603..108262768 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGAGAGGACGTGGAGGAT Chr3:108262663..108262682 60.07 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000274917 (Chr3:108262603..108262768 -)
Downstram Exon
ENSMUSE00000587557 (Chr3:108260987..108261386 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGAGAGGACGTGGAGGAT Chr3:108262663..108262682 60.07 55 ACCGAGTCAAATCCATCAGG Chr3:108261339..108261358 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000670678 Chr3:108339214..108339444 AAAAACTGAAAGGCGCACAC Chr3:108339300..108339319 60.29 45
upstream ENSMUSE00000711246 Chr3:108339214..108339435 AAAAACTGAAAGGCGCACAC Chr3:108339300..108339319 60.29 45
upstream ENSMUSE00000716391 Chr3:108339214..108339435 AAAAACTGAAAGGCGCACAC Chr3:108339300..108339319 60.29 45
upstream ENSMUSE00000670694 Chr3:108294917..108295037 GAGTACACAGCGTGCGACAG Chr3:108295003..108295022 60.68 60
upstream ENSMUSE00000587565 Chr3:108291748..108291940 GGAGGTCGATGACAGCATCT Chr3:108291773..108291792 60.23 55
upstream ENSMUSE00000670693 Chr3:108291748..108291940 GGAGGTCGATGACAGCATCT Chr3:108291773..108291792 60.23 55
upstream ENSMUSE00000587564 Chr3:108285249..108285396 GCCGTCAACCTAAAGCAGTC Chr3:108285307..108285326 59.88 55
upstream ENSMUSE00000670692 Chr3:108284712..108284780 TGACTCCAGGTGGATGAAGA Chr3:108284729..108284748 59.18 50
upstream ENSMUSE00000587563 Chr3:108284700..108284780 TGACTCCAGGTGGATGAAGA Chr3:108284729..108284748 59.18 50
upstream ENSMUSE00000564704 Chr3:108284182..108284287 AAGCCCGTGCTTGTTAGAAA Chr3:108284196..108284215 59.88 45
upstream ENSMUSE00000587560 Chr3:108283894..108284043 ATCCGTGTGATGCTGACAAA Chr3:108283901..108283920 60.12 45
upstream ENSMUSE00000587559 Chr3:108277879..108277967 AAGGATCTTCCACCTGCAAA Chr3:108277945..108277964 59.67 45
upstream ENSMUSE00000587558 Chr3:108275641..108275818 ACAAATGGGCCATACCAAAA Chr3:108275786..108275805 60.05 40
upstream ENSMUSE00000274871 Chr3:108274887..108275015 CGGTTCTCAGTGGGATCAAC Chr3:108274909..108274928 60.51 55
upstream ENSMUSE00000274865 Chr3:108274266..108274356 GGTGCCTCAGACAACGACTT Chr3:108274299..108274318 60.31 55
upstream ENSMUSE00000274859 Chr3:108272820..108272925 GGCCAGGATCACATTTGTCT Chr3:108272864..108272883 59.93 50
upstream ENSMUSE00000274851 Chr3:108272446..108272583 ACTCCTGTGGAGACGTGGAA Chr3:108272543..108272562 60.71 55
upstream ENSMUSE00000335040 Chr3:108270671..108270934 GTCCTGCTGGCCATTACATC Chr3:108270785..108270804 60.49 55
upstream ENSMUSE00000373240 Chr3:108268524..108268697 ACAACGACTGCACCTTCTCC Chr3:108268662..108268681 60.31 55
upstream ENSMUSE00000364934 Chr3:108267173..108267353 AGCCTATGTCTGCCAGGTTG Chr3:108267251..108267270 60.28 55
upstream ENSMUSE00000402645 Chr3:108266388..108266484 GAATCGTCTCCCCAGTTGAA Chr3:108266438..108266457 60.05 50
upstream ENSMUSE00000362165 Chr3:108265808..108265909 TGGAAGATCAACCACCATCC Chr3:108265860..108265879 60.72 50
upstream ENSMUSE00000274935 Chr3:108264114..108264240 GCTCTGATGGGACCTGTGAT Chr3:108264216..108264235 60.08 55
upstream ENSMUSE00000274927 Chr3:108263857..108264035 TTACATGTGGCGAGAACCAA Chr3:108264008..108264027 60.11 45
upstream ENSMUSE00000670677 Chr3:108262722..108262768 No primer for this exon
upstream ENSMUSE00000670680 Chr3:108262721..108262768 No primer for this exon
upstream ENSMUSE00000274917 Chr3:108262603..108262768 AAGGAGAGGACGTGGAGGAT Chr3:108262663..108262682 60.07 55

*** Putative Vector Insertion (Chr 3: 108261387 - 108262602) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000670679 Chr3:108261160..108261205 No primer for this exon
downstream ENSMUSE00000670676 Chr3:108261102..108261206 TTGAGGCAAGCGTAGAGACA Chr3:108261106..108261125 59.74 50
downstream ENSMUSE00000587557 Chr3:108260987..108261386 ACCGAGTCAAATCCATCAGG Chr3:108261339..108261358 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTCTTTGGGAAGATCAAA Chr3:108262616..108262636 59.1 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTCTTTGGGAAGATCAAA Chr3:108262616..108262636 59.1 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040412