Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28402
Trapped Gene
Tmem108 (ENSMUSG00000042757)
Vector Insertion
Chr 9: 103387114 - 103391518
Public Clones not available
Private Clones OST31931 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000318056 (Chr9:103391519..103391673 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGTGTGCTGCATGAGGAG Chr9:103391643..103391662 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000318056 (Chr9:103391519..103391673 -)
Downstram Exon
ENSMUSE00000530513 (Chr9:103386108..103387113 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGTGTGCTGCATGAGGAG Chr9:103391643..103391662 60.06 55 GGAACCTCTACATGCCCAGA Chr9:103386694..103386713 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634725 Chr9:103664085..103664132 No primer for this exon
upstream ENSMUSE00000634724 Chr9:103655185..103655297 ATGGGTTGCGAGGATGTAAG Chr9:103655219..103655238 59.96 50
upstream ENSMUSE00000634723 Chr9:103512041..103512126 GGCCCTCTATTGCCAACTATT Chr9:103512043..103512063 59.48 47.62
upstream ENSMUSE00000503630 Chr9:103401132..103402538 TTTGATGCCACTGTCTCAGC Chr9:103401473..103401492 59.99 50
upstream ENSMUSE00000318056 Chr9:103391519..103391673 ACAGTGTGCTGCATGAGGAG Chr9:103391643..103391662 60.06 55

*** Putative Vector Insertion (Chr 9: 103387114 - 103391518) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000530513 Chr9:103386108..103387113 GGAACCTCTACATGCCCAGA Chr9:103386694..103386713 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCCTGGCACCTCTACTGT Chr9:103391529..103391549 60.47 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCCTGGCACCTCTACTGT Chr9:103391529..103391549 60.47 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042757