Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28405
Trapped Gene
Pigu (ENSMUSG00000038383)
Vector Insertion
Chr 2: 155104386 - 155118425
Public Clones not available
Private Clones OST31865 (lexicon) OST9547 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000411903 (Chr2:155118426..155118568 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGTGGCACCTATGGATTT Chr2:155118488..155118507 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000411903 (Chr2:155118426..155118568 -)
Downstram Exon
ENSMUSE00000506147 (Chr2:155103980..155104385 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGTGGCACCTATGGATTT Chr2:155118488..155118507 59.81 50 TCAAGTAGAGGCCGTGTGTG Chr2:155104291..155104310 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000554532 Chr2:155183002..155183160 CAGTTTGGCCGAGTTCATTT Chr2:155183047..155183066 60.11 45
upstream ENSMUSE00000332445 Chr2:155171384..155171448 GCACTGTTGGATCTGGGAGT Chr2:155171415..155171434 60.12 55
upstream ENSMUSE00000438469 Chr2:155162418..155162477 No primer for this exon
upstream ENSMUSE00000375530 Chr2:155161097..155161159 CCTCACTGCTATTGCCCTGT Chr2:155161129..155161148 60.28 55
upstream ENSMUSE00000339917 Chr2:155156885..155156994 AAATGCGCTACATCCCTCTG Chr2:155156899..155156918 60.24 50
upstream ENSMUSE00000360863 Chr2:155154317..155154417 AGTCTACCTGCGCCATCAAC Chr2:155154357..155154376 60.28 55
upstream ENSMUSE00000403749 Chr2:155140238..155140335 GCGTTTTCCTCAGTGCTGTT Chr2:155140313..155140332 60.44 50
upstream ENSMUSE00000326025 Chr2:155126937..155127091 GCCTTCTGGATCTTCTCGTG Chr2:155127039..155127058 59.95 55
upstream ENSMUSE00000326015 Chr2:155124782..155124925 GCGTGTTTCAGATCAACGTC Chr2:155124817..155124836 59.3 50
upstream ENSMUSE00000503422 Chr2:155122819..155122943 TATCCAACTGTGGGGGATGT Chr2:155122866..155122885 60.05 50
upstream ENSMUSE00000411903 Chr2:155118426..155118568 CCTGTGGCACCTATGGATTT Chr2:155118488..155118507 59.81 50

*** Putative Vector Insertion (Chr 2: 155104386 - 155118425) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000506147 Chr2:155103980..155104385 TCAAGTAGAGGCCGTGTGTG Chr2:155104291..155104310 59.9 55
downstream ENSMUSE00000639715 Chr2:155073242..155073334 CCTCCTTTTCGTCCTCTTTG Chr2:155073265..155073284 58.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCCTCTTTATGTCCTCCA Chr2:155109401..155109421 60.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAGTTGAGGGTCGCACAG Chr2:155109402..155109422 60.44 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038383