Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28420
Trapped Gene
Srgn (ENSMUSG00000020077)
Vector Insertion
Chr 10: 61957176 - 61957855
Public Clones not available
Private Clones OST31456 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666252 (Chr10:61957432..61957854 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666252 (Chr10:61957432..61957854 -)
Downstram Exon
ENSMUSE00000100393 (Chr10:61957177..61957854 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666257 Chr10:61990087..61990199 No primer for this exon
upstream ENSMUSE00000666254 Chr10:61970661..61970686 No primer for this exon
upstream ENSMUSE00000100394 Chr10:61970390..61970504 No primer for this exon
upstream ENSMUSE00000666253 Chr10:61970390..61970489 No primer for this exon
upstream ENSMUSE00000666256 Chr10:61970390..61970584 No primer for this exon
upstream ENSMUSE00000100395 Chr10:61960527..61960671 No primer for this exon
upstream ENSMUSE00000666252 Chr10:61957432..61957854 No primer for this exon
upstream ENSMUSE00000100393 Chr10:61957177..61957854 No primer for this exon

*** Putative Vector Insertion (Chr 10: 61957176 - 61957855) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000666255 Chr10:61956581..61957854 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAGGATGGAAGGACCCTCA Chr10:61957837..61957857 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAGGATGGAAGGACCCTCA Chr10:61957837..61957857 59.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020077