Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28426
Trapped Gene
Tnni1 (ENSMUSG00000026418)
Vector Insertion
Chr 1: 137704188 - 137705209
Public Clones not available
Private Clones OST31306 (lexicon) OST31272 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158882 (Chr1:137704098..137704187 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTCCATGCCAAGGTAGAG Chr1:137704111..137704130 59.45 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158882 (Chr1:137704098..137704187 +)
Downstram Exon
ENSMUSE00000158887 (Chr1:137705210..137705386 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTCCATGCCAAGGTAGAG Chr1:137704111..137704130 59.45 55 CCTTGTGCTTAGAGCCCAGT Chr1:137705333..137705352 59.5 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690462 Chr1:137701424..137701438 No primer for this exon
upstream ENSMUSE00000366440 Chr1:137701630..137701671 CCTCCCGTAAACTCATGCTG Chr1:137701649..137701668 60.65 55
upstream ENSMUSE00000158877 Chr1:137702076..137702207 AGGCTGAGAAGGTGCGTTAC Chr1:137702131..137702150 59.5 55
upstream ENSMUSE00000158882 Chr1:137704098..137704187 AGCTCCATGCCAAGGTAGAG Chr1:137704111..137704130 59.45 55

*** Putative Vector Insertion (Chr 1: 137704188 - 137705209) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158887 Chr1:137705210..137705386 CCTTGTGCTTAGAGCCCAGT Chr1:137705333..137705352 59.5 55
downstream ENSMUSE00000158885 Chr1:137706203..137706312 GCCAGACATAGCCTCCACAT Chr1:137706259..137706278 60.1 55
downstream ENSMUSE00000412315 Chr1:137707190..137707564 GGCACGAGCAGAAAGATAGG Chr1:137707269..137707288 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCACTTGTGAGGTAATCG Chr1:137704225..137704245 60.52 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCCTCCACAACACCAGAG Chr1:137704167..137704187 61.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026418