Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28437
Trapped Gene
Crxos1 (ENSMUSG00000074365)
Vector Insertion
Chr 7: 16485643 - 16488198
Public Clones not available
Private Clones OST31135 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677022 (Chr7:16483794..16485642 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTCATCACAGTCGCCTCA Chr7:16484730..16484749 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677022 (Chr7:16483794..16485642 +)
Downstram Exon
ENSMUSE00000637144 (Chr7:16488199..16488356 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTCATCACAGTCGCCTCA Chr7:16484730..16484749 59.98 50 TTAGGGCAACGGTCTGTCTC Chr7:16488301..16488320 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677026 Chr7:16467966..16468133 ACAGATAGCCCCAGGACCTC Chr7:16468073..16468092 60.48 60
upstream ENSMUSE00000677025 Chr7:16468868..16468892 No primer for this exon
upstream ENSMUSE00000677024 Chr7:16475944..16475998 GACCTGTTTACTGGTGGGAGTC Chr7:16475944..16475965 59.9 54.54
upstream ENSMUSE00000637149 Chr7:16481473..16481606 GAGCTACAGGCGAAATGGAA Chr7:16481568..16481587 60.35 50
upstream ENSMUSE00000637146 Chr7:16482753..16482901 CCTCCAGGATCGAAAGATCA Chr7:16482844..16482863 60.15 50
upstream ENSMUSE00000677023 Chr7:16482753..16482901 CCTCCAGGATCGAAAGATCA Chr7:16482844..16482863 60.15 50
upstream ENSMUSE00000637145 Chr7:16483794..16483965 CAGGCTCATTCCCATCAATC Chr7:16483925..16483944 60.43 50
upstream ENSMUSE00000677022 Chr7:16483794..16485642 CTTTCATCACAGTCGCCTCA Chr7:16484730..16484749 59.98 50

*** Putative Vector Insertion (Chr 7: 16485643 - 16488198) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000637144 Chr7:16488199..16488356 TTAGGGCAACGGTCTGTCTC Chr7:16488301..16488320 60.26 55
downstream ENSMUSE00000637143 Chr7:16489049..16489358 CCCCACCAAGAAGTTGAAAA Chr7:16489309..16489328 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGATCTGTGCCTGCTTGTG Chr7:16485650..16485670 59.86 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGATCTGTGCCTGCTTGTG Chr7:16485650..16485670 59.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074365