Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28448
Trapped Gene
Dapk3 (ENSMUSG00000034974)
Vector Insertion
Chr 10: 80653257 - 80653342
Public Clones not available
Private Clones OST30734 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000302787 (Chr10:80653127..80653256 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTCATCGACTTTGGCATC Chr10:80653176..80653195 60.37 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000302787 (Chr10:80653127..80653256 +)
Downstram Exon
ENSMUSE00000574672 (Chr10:80653343..80653391 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTCATCGACTTTGGCATC Chr10:80653176..80653195 60.37 50 AGCCAAGTGGCTCATAGTTCA Chr10:80653377..80653397 59.89 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349168 Chr10:80646663..80646820 CATGTCCACATTCAGGCAAG Chr10:80646758..80646777 60.11 50
upstream ENSMUSE00000302799 Chr10:80652684..80653044 AAGGAGTCATTGACGGAGGA Chr10:80652943..80652962 59.65 50
upstream ENSMUSE00000302787 Chr10:80653127..80653256 AGCTCATCGACTTTGGCATC Chr10:80653176..80653195 60.37 50

*** Putative Vector Insertion (Chr 10: 80653257 - 80653342) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000574672 Chr10:80653343..80653391 AGCCAAGTGGCTCATAGTTCA Chr10:80653377..80653397 59.89 47.62
downstream ENSMUSE00000302769 Chr10:80653787..80653813 TGTAGGTGATGACGCCAATG Chr10:80653812..80653831 60.54 50
downstream ENSMUSE00000302762 Chr10:80654504..80654656 AGATGTTCGTCAGCGTCTCC Chr10:80654565..80654584 60.42 55
downstream ENSMUSE00000302754 Chr10:80655042..80655087 No primer for this exon
downstream ENSMUSE00000302750 Chr10:80655171..80655729 GGGACTTGAGGCTGTACTCG Chr10:80655258..80655277 59.87 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCCTGCACAGCCATAATC Chr10:80653293..80653313 60.49 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAAGAACATCTTTGGCACA Chr10:80653224..80653245 59.31 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034974