Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28450
Trapped Gene
St5 (ENSMUSG00000031024)
Vector Insertion
Chr 7: 116667424 - 116668195
Public Clones not available
Private Clones OST30690 (lexicon)
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000506992 (Chr7:116667434..116668194 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGATCACTTCGCCCTTTTT Chr7:116667607..116667626 60.07 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000506992 (Chr7:116667434..116668194 -)
Downstram Exon
ENSMUSE00000333624 (Chr7:116667425..116668194 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGATCACTTCGCCCTTTTT Chr7:116667607..116667626 60.07 45 GCAAGACTCCATCCAAGCTC Chr7:116667864..116667883 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466750 Chr7:116760572..116760661 CAAGAGACTGCTTGGGCTCT Chr7:116760637..116760656 59.74 55
upstream ENSMUSE00000514123 Chr7:116759812..116760082 GCAAGAAATCACCCGGACTA Chr7:116759816..116759835 60.07 50
upstream ENSMUSE00000359869 Chr7:116713521..116713625 AGAGCCGAAATGACCATGAC Chr7:116713590..116713609 60.08 50
upstream ENSMUSE00000384284 Chr7:116699725..116700975 CATAGCCTGGGTATCCGAGA Chr7:116700568..116700587 60.05 55
upstream ENSMUSE00000277150 Chr7:116696489..116696625 TCCTTCGAGTTTGAGGATGC Chr7:116696602..116696621 60.34 50
upstream ENSMUSE00000277144 Chr7:116688591..116688742 TGGACTCTTTGCACAGGATG Chr7:116688633..116688652 59.83 50
upstream ENSMUSE00000277141 Chr7:116685834..116686049 ACATGATGCTGTTGGCTCAG Chr7:116685930..116685949 59.86 50
upstream ENSMUSE00000369167 Chr7:116684850..116684946 GTCCAGCCTTGAGACAGCAT Chr7:116684859..116684878 60.42 55
upstream ENSMUSE00000404874 Chr7:116683906..116683950 No primer for this exon
upstream ENSMUSE00000376492 Chr7:116683176..116683360 GAAGAAGCCATCTCGGAACA Chr7:116683211..116683230 60.34 50
upstream ENSMUSE00000205638 Chr7:116682448..116682557 AGCTATCCCCCAGTTTTGCT Chr7:116682491..116682510 60.1 50
upstream ENSMUSE00000205635 Chr7:116681790..116681859 AGGCGCTTTGGCTATTGTAG Chr7:116681800..116681819 59.52 50
upstream ENSMUSE00000205633 Chr7:116678808..116678885 CTAGGCTGCTTCGGTTTGTT Chr7:116678815..116678834 59.52 50
upstream ENSMUSE00000205640 Chr7:116678148..116678288 CTGCACTGGTCTACCCCTTC Chr7:116678232..116678251 59.72 60
upstream ENSMUSE00000528082 Chr7:116674596..116674744 CAGTGTGCGTCAGCTTATCC Chr7:116674654..116674673 59.47 55
upstream ENSMUSE00000205632 Chr7:116671128..116671305 GCCTTGCTCTACCCCTTCTC Chr7:116671255..116671274 60.35 60
upstream ENSMUSE00000205631 Chr7:116670858..116670899 CTGGGATCTGACCGATTCAT Chr7:116670865..116670884 59.89 50
upstream ENSMUSE00000205629 Chr7:116669740..116669851 ATGGACGACGAGGACACACT Chr7:116669832..116669851 60.6 55
upstream ENSMUSE00000205637 Chr7:116669053..116669292 AGTATCCGCCGTTTTCTTGA Chr7:116669124..116669143 59.71 45
upstream ENSMUSE00000205639 Chr7:116668777..116668863 GAGCGGGATGAACAAGTTTC Chr7:116668789..116668808 59.68 50
upstream ENSMUSE00000506992 Chr7:116667434..116668194 AGGATCACTTCGCCCTTTTT Chr7:116667607..116667626 60.07 45
upstream ENSMUSE00000333624 Chr7:116667425..116668194 AGGATCACTTCGCCCTTTTT Chr7:116667607..116667626 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCCCACAGGCAACAAGAT Chr7:116668183..116668203 60.92 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCCCACAGGCAACAAGAT Chr7:116668183..116668203 60.92 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031024