Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28475
Trapped Gene
2310008H04Rik (ENSMUSG00000041974)
Vector Insertion
Chr 16: 16048198 - 16053358
Public Clones not available
Private Clones OST30175 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000459069 (Chr16:16053359..16053609 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCACAAATACCAGGCGGATT Chr16:16053501..16053520 60.33 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000459069 (Chr16:16053359..16053609 -)
Downstram Exon
ENSMUSE00000459063 (Chr16:16048097..16048197 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCACAAATACCAGGCGGATT Chr16:16053501..16053520 60.33 45 TTCGATTCTGCAGTTCTTGG Chr16:16048135..16048154 59 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459117 Chr16:16146838..16146944 TGCACGTAGGAGATGTCTGG Chr16:16146863..16146882 59.85 55
upstream ENSMUSE00000459097 Chr16:16140801..16140956 TGAGACGGGGAAATTTCAAG Chr16:16140879..16140898 60.04 45
upstream ENSMUSE00000459090 Chr16:16140099..16140165 No primer for this exon
upstream ENSMUSE00000459083 Chr16:16118900..16119076 TGTCCCGAAGACGAAGACAT Chr16:16118905..16118924 60.66 50
upstream ENSMUSE00000459078 Chr16:16114920..16115074 AAGATCCTGGTGGGCCTAGT Chr16:16115013..16115032 59.96 55
upstream ENSMUSE00000704057 Chr16:16073245..16073313 TCCCCCAGGTCTCCTAAAAC Chr16:16073256..16073275 60.3 55
upstream ENSMUSE00000459069 Chr16:16053359..16053609 TCACAAATACCAGGCGGATT Chr16:16053501..16053520 60.33 45

*** Putative Vector Insertion (Chr 16: 16048198 - 16053358) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000459063 Chr16:16048097..16048197 TTCGATTCTGCAGTTCTTGG Chr16:16048135..16048154 59 45
downstream ENSMUSE00000459056 Chr16:16037583..16037802 TGCATTCCTCATGCAGTTCT Chr16:16037727..16037746 59.4 45
downstream ENSMUSE00000459048 Chr16:15968621..15968810 ATAGGTCTTCGCGCACTGTT Chr16:15968691..15968710 59.9 50
downstream ENSMUSE00000459041 Chr16:15966695..15966945 CCTGACTCCAGACCATAGGC Chr16:15966774..15966793 59.68 60
downstream ENSMUSE00000382433 Chr16:15936646..15936786 TCAAGAACACTTCCCCGAAC Chr16:15936712..15936731 60.09 50
downstream ENSMUSE00000280731 Chr16:15915393..15915480 AACTGAAGAGCCCTGGTGTC Chr16:15915439..15915458 59.31 55
downstream ENSMUSE00000280729 Chr16:15912762..15912902 TTGTCCCAGTGTTGGATGTG Chr16:15912815..15912834 60.42 50
downstream ENSMUSE00000280724 Chr16:15912612..15912671 TGCAACGTGTACTGCACTCAT Chr16:15912625..15912645 60.39 47.62
downstream ENSMUSE00000280719 Chr16:15904150..15904354 TCCTTAAAAGCGTCCCTGAA Chr16:15904133..15904152 59.82 45
downstream ENSMUSE00000280715 Chr16:15903002..15903148 GGGCACTCAGTTCATCCAGT Chr16:15903013..15903032 60.12 55
downstream ENSMUSE00000280709 Chr16:15897317..15897410 ACACACAGGCCACGAGAAAG Chr16:15897339..15897358 61.31 55
downstream ENSMUSE00000280703 Chr16:15895619..15895733 CTCAGGTCTCGTGGGACAGT Chr16:15895615..15895634 60.31 60
downstream ENSMUSE00000280694 Chr16:15895236..15895289 TCAGAGGCAGCAGACATCAG Chr16:15895221..15895240 60.29 55
downstream ENSMUSE00000352936 Chr16:15889320..15889878 AAGCCCAAGTAGCTGCAAAA Chr16:15889465..15889484 60.02 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr16:16053290..16053310 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTTTAACGTGACTGGGAAAA Chr16:16050293..16050316 60.02 34.78 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041974